A vagal reflex evoked by airway closure – Nature

Animals

All animal procedures followed ethical guidelines outlined in the NIH Guide for the Care and Use of Laboratory Animals, and all procedures were approved by the Institutional Animal Care and Use Committee at Harvard Medical School. Animals were maintained under constant environmental conditions (23 ± 1 °C, 46 ± 5% relative humidity) with food and water provided ad libitum in a 12-h light–dark cycle. All studies used adult male and female mice (6–24 weeks) in comparable numbers from mixed genetic backgrounds. All CreER mice and control littermates received tamoxifen (Sigma, T5648, 100 mg kg^–1, intraperitoneally, sunflower oil, twice 48 h apart) at least 10 days before further experiments. Mice containing Cre-dependent and Flp-dependent DTR alleles were a gift from M. Goulding, and Calca-eGFP mice were purchased (GENSAT, RRID: MMRRC_011187-UCD). For Pvalb-t2a-cre mice, only female Cre mice were used for husbandry owing to reported germline recombination in male breeders (Jackson Laboratory, 012358); male and female offspring were used for experiments. Olfr78-p2a-cre mice were generated by pronuclear injection of Cas9 protein, CRISPR sgRNAs targeting the Olfr78 locus 3′ UTR and a single-strand DNA template containing a p2a-cre gene cassette with 150 bp homology arms into C57BL/6 embryos. Knock-in pups were screened by PCR analysis, and correct expression of the transgene was verified by RNA in situ hybridization. All Cre driver lines used were viable and fertile, and abnormal phenotypes were not detected. Genotyping primers for Olfr78-p2a-cre mice were GGATGGTAAGGGTCACGTGTT (wild-type allele primer), CCGTTTTGGAAACAGCCTGG (p2a-cre allele 5′ primer) and TGCGAACCTCATCACTCGTT (p2a-cre allele 3′ primer), with differentially sized PCR products for the wild-type allele (192 bp) and knock-in allele (562 bp) in two separate reactions. All other mice were purchased from the Jackson Laboratory or made in-house and then deposited into the Jackson Laboratory: Ascl1-creERT2 (012882), Nkx2.1-ires-Flp (028577), Piezo2-eGFP-ires-cre (027719), inter-Gα_q-DREADD (26942), lsl-SALSA (31968), lsl-TdTomato (007914), snap25-Gcamp6s (25111), lsl-ChR2 (012569), C57BL/6J (000664), lsl-Gα_q-DREADD (026220), loxP-Piezo2 (027720), loxP-Piezo1 (029213), Vglut2-ires2-Flpo (030212), inter-Ai65 (021875), Vglut2-ires-cre (016963), Npy1r-gfp-cre (030544), P2ry1-ires-cre (29284), Pvalb-t2a-cre (012358), Crhr2-ires-Cre (33728), Npy2r-ires-Cre (29285), Calb1-ires2-cre (28532), Phox2b-cre (16223), Glp1r-ires-cre (29283), Mc4r-2a-Cre (030759) and Gpr65-ires-cre (029282).

Physiological measurements

Mice were anaesthetized with urethane (1.6–1.8 mg g^–1 intraperitoneal injection at least 30 min before surgery) or by isoflurane inhalation (1.5–2%) and warmed on a heated platform. Urethane was used for all experiments involving anaesthesia, except those in Extended Data Fig. 1, which explicitly describes the use of isoflurane in the figure legend. A tracheostomy was performed by inserting a cannula (18 or 20 gauge) to the carina and attaching the cannula to multipronged tubing with three openings: one to the atmosphere, one to a pressure transducer and one to an in-line gas and nebulized aerosol delivery port through which the animals are exposed to constant low-level flow rate (40 ml min^–1, which creates a tracheal pressure of 2–4 mmH₂O, controlled by a SAR-1000 ventilator, CWE, room air in Fig. 1 and 100% oxygen in subsequent figures to minimize hypoxic sighs). The following parameters were measured: respiration was measured using an in-line pressure transducer; heart rhythm by electrocardiogram recorded with three needle electrodes placed subcutaneously in paws; oesophageal, pharyngeal and/or thoracic pressure by a fluid-filled pressure transducer; and respiratory muscle contraction by electromyographic recording with a concentric bipolar needle electrode coupled to an amplifier (1–2 kHz sampling, MP150 amplifier system, Biopac AcqKnowledge v.4.2, v.4.5 or v.5.0). Where indicated, electromyography signals were digitally integrated (τ = 0.02 s). Pulse oximetry monitoring was performed using a MouseSTAT Jr with a mouse paw sensor (Kent Scientific).

Thoracic compression was applied by affixing a cuff around the rib cage spanning from the forelimbs to the xiphoid process and inflating the cuff slowly over 5 s to achieve a 40–60% reduction in peak tracheal pressure per breath for 10 s, unless otherwise indicated. The cuff pressure varied by animal based on size and cuff fit, and the maximal pressure was typically 5–30 cmH₂O. Airway suction was applied (5 s) by switching the in-line gas and nebulized aerosol delivery port to a digitally controlled vacuum reservoir (SCIREQ). The final applied suction pressure was determined by a pressure transducer in the trachea (low, −5 cm H₂O; high, −10 cm H₂O). Inhaled gases (Airgas, as in figures and legends, remaining percentage is N₂) were delivered in-line through the intake port on the ventilator (40 ml min^–1, 5 min trials). For measurements of the Hering–Breuer inspiratory reflex, lung inflation was achieved by increasing air flow through the ventilator (10–25 ml min^–1 g^–1 body weight, 10 s). Aerosols were administered in saline (PBS) and delivered (5 s, room temperature) by a nebulizer (ANP-1100 from SCIREQ with a 50% duty cycle). Reflexes were monitored for the subsequent 5 min. Nebulized aerosols were methacholine (10 mg ml^–1, PBS, Cayman, 23092), citric acid (30% w/v, Sigma, C1909), KCl (Sigma, 12636) and microbeads (Thermo Scientific, 0.2 mm F8811, 2.0 mm F8827). Gasps were defined as single-breath expirations with >50% amplitude increase compared with the previous and subsequent breath, as inferred by electromyography and tracheal or oesophageal pressure measurements. For stimulus-evoked changes in breathing, data were normalized by comparison to values from a 10 s baseline immediately before stimulus introduction.

Respiratory mechanics (Extended Data Figs. 1e, 8c and 10f) were measured using a flexiVent computer-controlled piston ventilator (SCIREQ). Animals were anaesthetized, tracheostomized (18 or 20 g cannula inserted to the carina) and attached to the ventilator. In Extended Data Fig. 1e, closed-chest animals were then paralyzed (1 mg kg^–1 pancuronium, intraperitoneally, Sigma-Aldrich, P1918); measurements shown in Extended Data Figs. 8c and 10f were performed using open-chest animals. Mice were ventilated at 150 breaths per min, a tidal volume of 10 ml kg^–1 and 3 cmH₂O positive end expiratory pressure with room air, unless otherwise indicated. Respiratory mechanics were assessed using the forced oscillation technique. Forced-expiratory volumes and pressure-volume loop manoeuvres were controlled by flexiVent software (flexiWare v.8.2).

Calcium imaging in vagal ganglia

In vivo imaging of vagal ganglia was performed as previously described^20,56 with minor modifications. In brief, mice were anaesthetized with urethane as described above and given PBS (300 μl, intraperitoneally) early in the surgery for homeostatic support. The left vagal ganglia was surgically exposed with branches superior to the ganglion transected and immobilized on a glass imaging platform attached to a manipulator. Calcium imaging was performed in most experiments (4 out of 7 mice) by two-photon microscopy (Olympus FVMPE resonant-scanning two-photon microscope with a piezoelectric Z-stepper (P-915, Physik Instrumente) and ×25, NA1.0 water-immersion objective) using a Ti:sapphire laser with dispersion compensation (MaiTai eHP DeepSee, SpectraPhysics), with excitation tuned to 940 to 975 nm, and fluorescence emission filtered with a 570 nm long-pass dichroic and 495–540 nm bandpass filter for GCaMP6 and a 575–645 nm bandpass filter for TdTomato signals. Volumetric images were typically collected at 1.5–3 Hz with focal planes 40–60 µm apart (Olympus FluoView software vFV31S-SW). For some experiments (3 out of 7 mice), calcium imaging was performed by confocal microscopy (Leica SP5 II with ×20, NA1.0 water-immersion objective) as previously described²⁰.

Two-channel images were motion-corrected using the ‘Image Stabilizer’ plugin in Fiji ImageJ (v.1.52p). Red fluorescence channel images were averaged to delineate individual cells and to demarcate regions of interest (ROIs). Unhealthy cells typically exhibited distinctively strong and unvarying GCaMP fluorescence relative to baseline and were excluded. Baseline fluorescence (F₀) was calculated from a 20 s period before stimulus onset, and ratiometric ΔF/F₀ intensity was calculated and normalized to tdTomato fluorescence intensity at each ROI to control for photobleaching, motion and GCaMP6 expression. Cells were coded as responsive if stimulus-evoked increases in ΔF/F₀ were at least 3 s.d. above the average fluorescence across the entire imaging session. For each responsive cell, the ratio (R_c/R_i) of response (ΔF/F₀) to compression and inflation was calculated; cells were classified as compression-selective if R_c/R_i > 2, as inflation-selective if R_c/R_i < 0.5 or as polymodal if 0.5 < R_c/R_i < 2. In Extended Data Fig. 2c, cells that did not respond to either airway inflation or airway closure were subsequently separated based on responsiveness to methacholine. Only some non-responsive neurons were selected for inclusion in indicated heatmaps based on computer randomization.

Vagus nerve optogenetics

Vagus nerve optogenetics were performed as previously described^6,14 using a DPSS laser light source (473 nm, 150 mW, Ultralaser) with software actuated illumination (10 s, 5–40 Hz, 10 ms dwell, 65–95 mW mm^–2 Prizmatix Pulser v.2.3.1 TTL software).

Cell ablations

Vagal sensory neurons were ablated as previously described^6,34 with DT (Sigma, D0564) solution (2–5 ng DT, PBS with 0.05% Fast Green FCF dye) injected (10 × 10 nl, serially) into surgically exposed vagal ganglia using a Nanoject III injector (Drummond). NEB ablation was achieved by intranasal administration (daily for 4 days) of solution containing 10 ng DT in 30 μl PBS. Cell ablation controls involved DT-administered Cre-negative littermates. Animals were allowed to recover for at least 2 weeks before subsequent experiments.

Vagal ganglia injection

Vagal anatomical tracing was performed as previously described^6,14 and involved AAV-eGFP (AAV9.CB7.Cl.eGFP.WPRE.rBG, 105542-AAV9, Addgene) and AAV-flex-TdTomato (pAAV-FLEX-tdTomato, 28306-AAV9, Addgene). Animals recovered for at least 2 weeks before tissue collection.

Whole-body plethysmography

Whole-body plethysmography was performed in freely behaving animals using a VivoFlow chamber system (SCIREQ). Chamber airflow was measured by a pneumotach at constant temperature and humidity with 0.5–0.6 l min^–1 bias flow, and respiratory measurements were amplified, digitized and recorded using the VivoFlow-usbAMP and lox2 software (v.2.10.5.28, SCIREQ). Gas challenges involved hypoxia (12% O₂), hypercapnia (5% CO₂, 21% O₂) and normoxia (21% O₂) balanced with nitrogen (Airgas). Animals were acclimated in the plethysmography chamber for 40–60 min, and then baseline respiratory data were recorded for 30 min. CNO injections involved brief removal of the animal from the chamber for administration of CNO (3 mg kg^–1, intraperitoneally, 100 μl PBS), and animals were immediately returned to the chamber for further recordings (30 min). Breaths were assigned and respiratory parameters (tidal volume, breaths per minute (BPM), minute volume) were calculated using Iox2 software (v.2.10.5.28 SCIREQ). Gasp-like breaths were manually identified from pneumotachographs and defined as a 50% increase in both inspiration and expiration compared with preceding and subsequent breaths. For quantification of eupneic breathing parameters, data were filtered to exclude respiratory events outside typical adult mouse breathing (tidal volume >2 ml or <0.05 ml; BPM > 400), averaged over the recording period (with a 7 min delay after CNO introduction), and breathing measures dependent on airway volume were normalized to the body weight of the animal.

Histology and expression analyses

For immunochemistry in tissue cryosections, tissues were collected from animals after transcardial perfusion of fixative (PBS followed by 4% paraformaldehyde in PBS), immersed in fixative (4% paraformaldehyde, PBS, overnight, 4 °C), cryopreserved (30% sucrose, PBS, overnight, 4 °C) and embedded in OCT. Tissue cryosections were obtained, washed (2 × 5 min, PBS, room temperature), permeabilized (0.3% Triton X-100, PBS, 10 min, room temperature), blocked (5% donkey serum, 0.3% Triton X-100, 0.05% Tween-20, PBS, 1 h, room temperature) and incubated with primary antibody diluted in blocking buffer (overnight, 4 °C; anti-NCAM1, 1:250, Cell Signaling Technology, 99746 S; anti-GFP, 5 μg ml^–1, Aves Labs, GFP-1020; anti-mCherry/RFP, 3 μg ml^–1, OriGene Technologies, AB0040-200; anti-HB-EGF (human), 1:250, R&D Systems, AF-259-NA; and anti-RFP, Rockland, 1:1,000, Rockland, 600-401-379). Slides were then washed (3 × 10 min, 0.3% Triton X-100, 0.05% Tween-20, PBS) and incubated with secondary antibodies in blocking buffer (4 h, room temperature, all 1:1,000, donkey polyclonal, Jackson Immunoresearch; anti-Chicken IgG-Alexa fluor 488, anti-rabbit IgG-Cy3, anti-rabbit IgG Cy5, anti-goat IgG Cy5 and anti-goat IgG Cy3; RRIDs: AB_2340375, AB_2307443, AB_2340607, AB_2340415 and AB_2307351, respectively). Samples were washed (3 × 10 min, 0.3% Triton X-100, PBS, room temperature), stained for nuclei visualization (5 min, 1:1,000 Hoechst 33342, PBS) and mounted (ProLong Glass Antifade; Thermo Fisher) for microscopy. RNA in situ hybridization for Piezo2 was performed on tissue cryosections using the probe and protocol involving hybridization chain reaction provided by the manufacturer (Molecular Instruments). Immunostained slides and native tissue fluorescence were imaged by either confocal microscopy (Leica SP5 II or Nikon Ti2) or by widefield microscopy (Zeiss AxioZoom or AxioObserver microscopes with Zen Blue software, v.2.6 and v.3.2, respectively). For whole-mount lung histology in Fig. 3h, tissue was stained and cleared using published iDisco methodology involving anti-mCherry/RFP primary antibody (6 μg ml^–1) and Cy5-conjugated anti-goat IgG secondary antibody (1:500) and imaged by light sheet microscopy (UltraMicroscope II by LaVison, ImSpector v.7.1.4).

Single-cell transcriptomics

Whole lungs below the trachea were collected from 10 Calca-eGFP and 10 Ascl1-creER;lsl-tdTomato mice (5–7 weeks old, equal male and female, 10 days after tamoxifen injection), pooled by strain, minced and incubated (60 min, 37 °C) in oxygenated papain dissociation buffer (Worthington Biochemical, LK003150). Residual tissue was mechanically dissociated through a 100 μm cell strainer, pelleted by centrifugation (400g, 7 min, 4 °C), washed, resuspended in red blood cell lysis buffer (150 mM NH₄Cl, 10 mM NaCHO₃ and 0.1 mM EDTA) for 5 min, pelleted and resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, PBS, 4 °C). Immune cells were depleted using anti-CD45 magnetic beads according to the manufacturer’s instructions (BioLegend, 480027), and the remaining cells were resuspended in viability buffer (TO-PRO-3 and CellTrace Violet, both 1:10,000, in RPMI 1640; Thermo Fisher, T3605, 65-0854-39 and 11835030, respectively). Cells were collected by FACS using a FACS Aria II (BD Bioscience) with gates to select for fluorescent reporter expression and viability (CellTrace Violet positive, TO-PRO-3 negative). Collected cells were individually encapsulated in nanodroplets using a 10x Genomics platform (v.3 chemistry). Single-cell cDNA was prepared according to the manufacturer’s protocol and sequenced at the Harvard Medical School Biopolymers Facility on a NextSeq 500 platform. For analysis, sequence reads were aligned to the mm10 reference transcriptome, and feature barcode matrices were generated using Cell Ranger (10x Genomics; pipeline v.3.1.0), and analysed in R (v.4.1.3) using Seurat (v.4.1.1) for quality control, pre-processing, normalization, clustering and differential expression analysis. Transformed matrices from both strains were integrated (nFeature = 3,000) before cluster identification and UMAP representation. Analysis used a standard process excluding cells with >15% mitochondrial reads or <500 unique features. Neuroendocrine cell clusters were identified for enriched expression of Epcam, Calca and Ascl1; genes to define additional lung cell types are depicted in Extended Data Fig. 9a. After differential expression analysis, gene ontology enrichment analysis used the top 50 most enriched genes ranked by significance (P value) using Enrichr⁶¹ (https://maayanlab.cloud/Enrichr/).

NEB calcium imaging

Ascl1-creER;lsl-SALSA;lsl-Gα_q-DREADD mice previously injected with tamoxifen (100 mg kg^–1 in sunflower oil, intraperitoneally, twice) were anaesthetized and transcardially perfused with 10 ml cold, oxygenated PBS. Lungs were inflated by introducing 2% low-melt agarose at 37 °C through a tracheal cannula and quickly chilled on ice (30 min). Lung lobes were resected, and 200-µm sections were obtained using a vibratome in cold, oxygenated imaging buffer (in mM: 115 NaCl, 5 KCl, 25 NaHCO₃, 1 MgCl₂, 2 CaCl₂, 10 glucose and 10 HEPES, pH 7.3). Slices were transferred to fresh imaging buffer (37 °C; 5% CO₂) for imaging (typically 30 min later). NEBs were identified based on tdTomato expression, and SALSA fluorescence was measured by confocal microscopy (Leica SP5 II with ×20, NA1.0 water-immersion objective, GCaMP6f, 488 nm excitation and 495–535 emission; tdTomato, 543 nm excitation and 565–615 emission). Imaging was performed with continuous perfusion of imaging buffer by gravity feed, and application of CNO or KCl as indicated in Extended Data Fig. 6a. Data were acquired using LAS AF software (v.2.3.6 Leica) and analysed in ImageJ.

Whole-nerve electrophysiology

Whole vagus nerve electrophysiology recording was performed as previously described^14,21,53 with minor modifications. In brief, urethane-anaesthetized animals (1.6 mg g^–1) were surgically prepared to administer airway suction, as described above for airway physiology measurements. The left vagus nerve was then transected, and the lung-connected nerve end was desheathed and placed on a pair of platinum–iridium electrodes. The nerve and electrode were immersed in halocarbon oil, and a ground electrode was placed on nearby muscle. Multiunit nerve activity was amplified (CP511, Grass Technologies), digitized (MP150, Biopac), recorded (AcqKnowledge software, v.4.5, Biopac) and integrated (Elenco, RS-400). Stimulus-induced responses were calculated as a percentage change from baseline activity and normalized to the response to serotonin (intraperitoneally, 10 mM, 400 μl PBS) over 100 s after administration.

Behaviour coding

Animals were video recorded (Logitech C920 HD PRO camera) during whole-body plethysmography. After acclimation (1 h), behaviours were manually scored using BORIS software (v.8.20.4)⁶² by a genotype-blinded investigator who measured time exploring, rearing, grooming, sniffing or hunching for 10 min periods before and at minutes 7–17 after CNO administration (3 mg kg^–1, intraperitoneally). Hunching was defined based on a characteristic recumbent posture and was typically associated with laboured breathing and ruffled fur.

Statistics and reproducibility

Data in graphs are presented as the mean ± s.e.m., unless otherwise indicated. Statistical analyses were performed using Prism (GraphPad) with statistical tests and sample sizes reported in figures and legends. All replicates were biological, unless otherwise indicated, and statistical tests were two-sided. All representative images are from at least three independent experiments. Sample sizes were determined based on previous expertise and publications in our field. Investigators were blinded to group allocations for plethysmography, physiological and behavioural experiments associated with Figs. 3–5 and Extended Data Fig. 7; group allocation was not blinded in other experiments. Where appropriate, exact and adjusted P values are reported in legends, and asterisks for significance are defined as follows: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Materials availability

All reagents that are not commercially available will be made available upon reasonable request. Olfr78-p2a-cre mice will be deposited to the Jackson Laboratory and will be available following completion of a standard material transfer agreement.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.