Data reporting
Table of Contents
No statistical methods were used to predetermine sample sizes. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.
Mammalian cell culture
HEK293T and U2OS cells were maintained in DMEM + Glutamax (Gibco, 10566-016) and 10% FBS (VWR, 89510-186). All cell lines were purchased directly from the UC Berkeley Cell Culture Facility, authenticated by short tandem repeat analysis and were routinely tested for mycoplasma contamination using a Mycoplasma PCR Detection kit (abmGood, G238). All cell lines tested negative for mycoplasma. For growth in galactose, DMEM with no glucose (Gibco, 11966025) was supplemented with 20 mM galactose.
Plasmid transfections were performed using polyethylenimine (PEI; Polysciences 23966-1) at a 1:6 ratio of DNA (in μg) to PEI (in μl at a 1 mg ml–1 stock concentration) or Lipofectamine 3000 transfection reagent per the manufacturers’ instructions (Thermo Fisher, L3000008). siRNA transfections were performed using indicated siRNAs (at a final concentration of 20 nM) and 3 μl (12-well plate) or 6 μl (6-well plate) of RNAiMAX (Thermo Fisher, 13778150). siRNA sequences used in this study are available in Supplementary Table 6. Lentiviruses were produced in HEK293T cells by co-transfection of lentiviral and packaging plasmids using Lipofectamine 3000. Virus-containing supernatants were collected 48 h and 72 h after transfection, supernatants were spun down and concentrated using a Lenti-X concentrator (Takara, 631232), aliquoted and stored at −80 °C for later use. For lentiviral transduction, 105 cells were seeded into 24-well plates and subjected to centrifugation for 45 min at 1,000g after addition of lentiviral particles and 6 μg ml–1 polybrene (Sigma-Aldrich, TR-1003). HEK293T transduced cells were drug-selected 24 h after infection with the following drug concentrations when applicable: puromycin (1 μg ml–1; Sigma-Aldrich, P8833); blasticidin (7.5 μg ml–1; Thermo Fisher, A1113903); or hygromycin (75 μg ml–1; Gibco, 10687010).
The following lentiviral constructs were used to infect human embryonic stem (ES) cells: (1) lentivirus vector pLG15_UBR4_GFP (sgUBR4) expressing GFP and the sgRNA sequence GGTCATCGAGAGGTACCGGG under the mU6 promoter; (2) lentivirus vector pLG15_NC766_mOrange (sgCNTRL) expressing mOrange and the control sgRNA sequence GGGTGATGCGGACAGGCCCG under the mU6 promoter. These lentiviruses were produced in HEK293T cells (American Type Culture Collection, CRL-3216) by co-transfection with three helper plasmids (pRSV-REV, pRRE and vesicular stomatitis virus G protein expression vector) using PEI. Lentiviral particles were then filtered through a 0.45 µm filter (EMD Millipore, SLFH05010), ultracentrifuged, resuspended in DMEM 100 times smaller than the original volume and stored at −80 °C. Human H1 ES cells were maintained in StemFlex medium (Thermo Fisher, A3349401) containing neomycin (final concentration of 300 µg ml–1; Thermo Fisher, 11811098) and hygromycin (final concentration of 50 µg ml–1; Sigma-Aldrich, H3274) on plates coated with Matrigel (Corning, 354234). Human H1 ES cells were used as the parental line for genetic engineering. ES cells were transfected with a piggybac vector with Ubc-dCas9-BFP-KRAB/EF1α-rtTA-T2A-hygromycin and a Super PiggyBac Transposase Expression vector (System BioSciences, PB210PA-1) by using Lipofectamine Stem Transfection reagent (Thermo Fisher, STEM00001). After 1 week of selection with 50 µg ml–1 hygromycin, BFP-positive ES cells were sorted by FACS and plated in a serial dilution series. Individual clones were picked under an inverted microscope in a tissue culture hood by manual scraping. Clones that were 100% BFP positive in flow cytometry analysis were selected and transfected with a piggybac vector with TetO-Ngn2/EF1a-rtTA-IRES-NEO and a Super PiggyBac Transposase Expression vector by using Lipofectamine Stem Transfection reagent. Cells selected by 300 µg ml–1 of neomycin for 2 weeks were used for further experiments.
To generate UBR4 knockdown cells, cultures were briefly dissociated using accutase (Innovative Cell Technologies, AT104), replated at a density of 5 × 105 cells per well in a 6-well plate on Matrigel in the presence of 10 µM of the ROCK inhibitor Y-27632 (Axon Medchem, 1683). At the same time as plating, lentivirus prepared as described above (3 µl per well of a 6-well plate) was added. The day after plating, medium was changed to StemFlex medium without Y-27632, and the following day, neomycin and hygromycin were reintroduced into the medium. For analysis of ISR activation, cells infected with either sgCNTRL or sgUBR4 lentivirus were treated with either 0 µM or 5 µM sodium arsenite (Fisher Scientific, 7142-16) for 8 h both in the presence and absence of 200 nM ISRIB (Sigma Aldrich, SML0843). After treatment, cells were dissociated using accutase, washed 3× with PBS and pelleted by table-top centrifugation. Cell pellets were snap-frozen in liquid nitrogen and stored at −80 °C until western blot analysis.
For iNeurons experiments, induced pluripotent stem cells (iPS cells) harbouring doxycycline-inducible murine neurogenin-2 (Ngn2) and expressing dCas9–KRAB in the WTC-11 background (gift from M. Ward, NIH) were maintained in mTeSR plus (StemCell Technologies, 100-0276) on Matrigel-coated plates (Corning, 356231). Guide RNAs (NTC: GTGCACCCGGCTAGGACCGG; UBR4: GGGGAGCCGCAGTAGTACGA) were cloned into the pMK1334 vector (gift from M. Kampmann, Addgene, 127965) and introduced to iPS cells by lentiviral transduction. Neuronal differentiation was performed as previously described42. In brief, iPS cells were dissociated using accutase (StemCell Technologies, 07920) and replated on Matrigel-coated plates in N2 induction medium containing DMEM/F12 with Glutamax (Gibco, 10565018), 1× MEM NEAA (Gibco, 11140050), 1× N-2 supplement (Gibco, 17502048), doxycycline (2 μg ml–1) and Chroman I (50 nM; MedChem Express, HY-15392). N2 induction medium was changed daily, omitting Chroman I. After 48–72 h of exposure to doxycycline, pre-differentiated neurons were dissociated by accutase treatment and replated onto poly-l-ornithine-coated (Sigma Aldrich, P3655) 12-well plates at 5 × 105 cells per well in neuronal maturation medium containing 50% BrainPhys (StemCell Technologies, 05790), 50% DMEM/F12 (Gibco, 11039021), 1× B-27 plus supplement (Gibco, A3582801), GDNF, BDNF, NT-3 (10 ng ml–1 each; PeproTech, 450-10, 450-02, 450-03), mouse laminin (1 μg ml–1; Gibco, 23017015), and doxycycline (2 μg ml–1). After 3 days, a full medium change was performed using neuronal maturation medium containing 100% BrainPhys without doxycycline. Drug treatments were conducted on day 7 after replating onto poly-l-ornithine-coated plates.
Plasmids
The list of all constructs used in this study are provided in Supplementary Table 4. Most cloning was performed using Gibson assembly using HIFI DNA Assembly master mix (NEB, E2621L).
Generation of CRISPR–cas9 genome edited cell lines
All CRISPR–cas9 edited cell lines used in this publication were generated from HEK293T cells. sgRNA sequences were designed using the online resource provided by IDT. DNA oligonucleotides for sgRNA and their complementary sequence were phosphorylated (NEB, M0201), annealed and ligated (NEB, M0202) into pX330. HEK293T cells were cultured in a 6-well plate and transfected at 50% confluence with 2 µg of px330 plasmids (and 1 μl of 10 μM single stranded donor oligonucleotide when applicable) using Mirus TransIT-293 Transfection reagent (Mirus, MIR2705). At 48 h after transfection, individual clones were expanded in 96-well plates. Homozygous clones were screened by PCR and DNA sequencing and confirmed by western blotting when applicable.
HEK293T Flag–UBR4 and Flag–UBR5 cells were generated as previously described10. For generation of ΔUBR4 cells, two sgRNAs were used to remove exon 2 with protospacer sequences 5′-ggttgatgatactatctacc-3′ and 5′-ccttacctaggctaaccaag-3′. ΔKCMF1 cells were generated in the Flag–UBR4 background, two sgRNAs were used to remove exon 3 with protospacer sequences 5′-tgtaatctcagctgctccgg-3′ and 5′-acggtatcattacactgagc-3′. For generation of KCMF1–Flag, we used the following sgRNA: 5′-gaattgggatgtcatcaaag-3′ and ssODN 5′-gctttagaaaacctaaatttaaaagagagtaataaaggaaatgagcctccaccacctcctcttggcgcgccagactacaaagaccatgacggtgattataaagatcatgatatcgattacaaggatgacgatgacaagtgatgacatcccaattcgcagacaatgtcctctgtgctgtatttgccaatgaaagtggacaa-3′.
UBR4-ΔKCMF1 (Δ2333–2498), UBR4-ΔUBR (Δ1653–1725), UBR4-ΔCALM (Δ4036–4131) were generated in the Flag–UBR4 background with the following protospacer sequences that created in-frame deletions: UBR4-ΔKCMF1: 5′-gggtttccaccaataccagc-3′ and 5′-ctgtgacacacgctcactat-3′; UBR4-ΔUBR: 5′-caagccaccctttatagctc-3′ and 5′-gttgactcgcaaatgacccg-3′; UBR4-ΔCALM: 5′-gagcgtgttaagataagcag-3′ and 5′-gagtgaccttaagctcaatg-3′.
ΔUBR5 cells were generated as previously described43. For generation of ΔRNF126 cells, the following sgRNAs were used to remove exon 2: 5′-gccctccaggacccacgggtt-3′ and 5′-gctcttccagcctcttcaac-3′.
DELE1–HA cells were generated using the following sgRNAs: 5′-gaaaggagtgttgtaagact-3′ and 5′-agtcttacaacactcctttc-3′ and ssODN 5′-ctattcccccacacccctacccactggaaaggagtgttgtaagactaggttttggctacccgtatgatgttccggattacgctggctacccatacgacgtcccagactacgctggctacccatacgacgtcccagactacgcttaaggtgagataaaacatagtccctggtgcctcttaggggccagagcgggcaggagg-3′.
Synthetic lethal whole-genome CRISPR–Cas9 screen
We followed a CRISPR–Cas9 screening protocol as previously described44. In brief, pooled sgRNA viruses were obtained by transfection of the Human GeCKO v2 library (Addgene, 1000000048) into HEK293T cells together with lentiviral packaging plasmids using Mirus TransIT-293 Transfection reagent. HEK293T WT and ΔUBR4 cells were spinfected with the pooled sgRNA virus at a multiplicity of infection of 0.3 with 8 μg ml–1 polybrene in 12-well plates. Cells were trypsinized and replated the next day onto 15-cm plates and selected with puromycin (1 μg ml–1) for 3 days, until the untransduced control cells were all dead. After puromycin selection, cells were split and seeded at a density of 2.5 × 106 cells per 15-cm plate and this marked day 0. Cells were grown in DMEM + Glutamax with penicillin–streptomycin (Gibco, 15070063) and split every 3 days until day 21, the final day of the screen. Cells were cultured such that a representation of at least 500 cells per sgRNA element was maintained throughout the screen. A total of 70 × 106 cells were collected at day 0 and day 21 for genomic DNA extraction, which was performed using a Zymo Research Quick-gDNA MidiPrep kits (Zymo Research, D3100) according to the manufacturer’s protocol. sgRNA-encoding regions were amplified with Q5 High-Fidelity DNA polymerase (NEB, M0491). All PCRs for a given sample were pooled, and 500 µl was used to perform ampure bead clean-up with 0.65× and 0.9× cut-off values (Beckman Coulter, A63881). Samples were run on a 8% TBE gel (Thermo Fisher, EC6215BOX), gel purified and sequenced at the UC Berkeley Vincent J. Coates Genomics Sequencing laboratory on a HiSeq4000. sgRNA counts were processed using count_spacers.py44. Subsequently, CasTLE45 was run to identify top candidate genes that were synthetic lethal or protective in ΔUBR4 cells compared with WT cells. We used the non-expressed genes (as defined by having zero transcripts per million (TPM) in HEK293T WT cells by RNA-seq analysis, n = 4,710) as the negative control gene set instead of non-targeting control guides (sgNTCs) to run CasTLE. This allows for a much more representative background distribution because there are few sgNTCs in the lentiv2 library and they are known to introduce biases due to the absence of cutting46. To identify pathways enriched in the candidate genes, we took genes in the 5% top CasTLE score with a negative CasTLE Effect and ran Gene Ontology enrichment analysis (Cytoscape, ClueGO v.3.7.1). CasTLE effects and scores are available in Supplementary Table 1.
Mass spectrometry
Mass spectrometry was performed on immunoprecipitates prepared from 40 15-cm plates of endogenously Flag-tagged UBR4 or KCMF1 HEK293T cell lines (Supplementary Table 2). Cells were lysed in lysis buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.2% Nonidet P-40, benzonase (Sigma-Aldrich, E1014), 1× complete protease inhibitor cocktail (Roche, 11836170001), 1× PMSF, 10 mM NaF and 1 mM sodium orthovanadate), lysed extracts were clarified by centrifugation at 21,000g and bound to anti-Flag M2 affinity resin (Sigma-Aldrich, A2220) for 2 h at 4 °C. Immunoprecipitates were then washed 4× and eluted 3× at 30 °C with 0.5 mg ml–1 of 3×Flag peptide (Sigma, F4799) buffered in 1× PBS plus 0.1% Triton X-100. Elutions were pooled and precipitated overnight at 4 °C with 20% trichloroacetic acid. Spun down pellets were washed 3× with an ice-cold acetone and 0.1 N HCl solution, dried, resolubilized in 8 M urea buffered in 100 mM Tris pH 8.5, reduced with TCEP, at a final concentration of 5 mM, (Sigma-Aldrich, C4706) for 20 min, alkylated with iodoacetamide, at a final concentration of 10 mM (Thermo Fisher, A39271) for 15 min, diluted 4-fold with 100 mM Tris pH 8.5, and digested with 0.5 mg ml–1 of trypsin (Promega, v5111) supplemented with CaCl2 (at a final concentration of 1 mM) overnight at 37 °C. Trypsin-digested samples were submitted to the Vincent J. Coates Proteomics/Mass Spectrometry Laboratory at UC Berkeley for analysis. Peptides were processed using multidimensional protein identification technology (MudPIT) and ran on a LTQ XL linear ion trap mass spectrometer. To identify high-confidence interactors, CompPASS analysis47 was performed against mass spectrometry results from unrelated Flag immunoprecipitates performed in our laboratory. For Fig. 1e, protein spectral counts were normalized to the total spectral counts, multiplied by 106, added 1 and the log2 was taken (log2((spectral countsprotein/total spectral counts) × 106 + 1). Proteins with more than 2 spectral counts and a CompPASS z score > 80% of max z score in Flag–UBR4 sample (Flag–UBR4 is an average of 2 biological replicates) or 3 spectral counts and a CompPASS z score > 80% of max z score in Flag–KCMF1 sample were plotted on a scatter plot. For Extended Data Fig. 2d, we normalized values in a similar manner but used spectral counts of the bait instead of total spectral counts. A subset of the identified interactors are plotted in Extended Data Fig. 2d. Total spectral counts and z scores computed using CompPASS are available in Supplementary Table 2.
Growth competition assays
HEK293T and ΔUBR4 cells were transduced to express either GFP or mCherry using the lentiviral pLVX-GFP-P2A-Blasticidin or pLVX-mCherry-P2A-Blasticidin vector, respectively. For sgRNA depletion competition assays, 5 × 104 WT–GFP and 5 × 104 ΔUBR4–mCherry cells were mixed in 24-well plates and spin-infected with lentiviral particles as described above. After 24 h, viral supernatants were removed and cells were expanded to 6-well plates and selected with puromycin for 5 days. Competition assays were conducted for 12 days after selection. When indicated, ISRIB was added throughout the competition assay after antibiotic selection. The percentage of mCherry+ cells and GFP+ cells was determined using a BD LSRFortessa instrument, analysed using FlowJo 10.8.1 and normalized to the sgCNTRL ratio. The ratio of mCherry-labelled to GFP-labelled cells is reported as (ΔUBR4sgRNA/WTsgRNA)/(ΔUBR4sgCNTRL/WTsgCNTRL) for each sgRNA tested.
For drug competition assays, 5 × 104 WT–GFP and 5 × 104 ΔUBR4–mCherry cells were mixed in 6-well plates. The next day, indicated drugs were added for 72 h. The ratio of mCherry+/GFP+ cells was determined using a BD LSRFortessa instrument, analysed using FlowJo 10.8.1 and normalized to the untreated sample. The ratio of mCherry-labelled to GFP-labelled cells is reported as (ΔUBR4treatment/WTtreatment)/(ΔUBR4control/WTcontrol). For growth in DMEM + galactose, competition assays were performed for 11 days and the mCherry/GFP ratio was normalized to the ratio of growth in DMEM + glucose. Gating strategies for flow cytometry analysis are shown in Supplementary Fig. 2.
Drug treatments
For 3-day growth competition experiments with drug-treated cells, we used the following drug concentrations: 2.5 μM sodium arsenite (Ricca Chemical, 714216); 2.5 μM oligomycin A (Santa Cruz Biotechnology, sc-201551); 50 nM rotenone (Sigma-Aldrich, R8875-1G); 10 μM CCCP (Cayman Chemicals, 25458); 5 μM BTdCPU (EMD Millipore, 324892); 10 nM thapsigargin (Sigma-Aldrich, T9033-.5MG); 100 nM tunicamycin (Calbiochem, 65438010); 1.25 μM EN6 (Sigma-Aldrich, SML2689-5MG)48; 4 nM bafilomycin A1 (Selleck Chemicals, S1413); and 40 nM 17-DMAG (Selleck Chemicals, S1142). For overnight drug treatments, we used 5 μM sodium arsenite, 10 μM CCCP, 0.2 μM oligomycin, 5 μM antimycin A (Santa Cruz Biotechnology, sc-202467) or otherwise indicated in the figure legends. To inhibit the proteasome or autophagy, we used 2 μM carfilzomib (Selleck Chemicals, S2853) for 6 h or 700 nM bafilomycin A1 for 6 h, respectively. ISRIB (Sigma-Aldrich, SML0843) was used at a concentration of 200 nM.
Mitochondrial import assay
Mitochondrial split-GFP import flow-cytometry-based assays measuring reconstitution of GFP after transport of a GFP11-tagged protein into the mitochondrial matrix were performed based on previously described imaging experiments20. HEK293T and ΔUBR4 cells were transfected with MTS-mScarlett-GFP1-10-IRES-Puro and seeded in 96-well plates at a density of one cell per well and selected for individual clones with random integration using puromycin selection. Single-cell clones with identical expression of mScarlett determined by flow cytometry were selected and used for further experiments. Cells were transfected with 0.5 μg of inducible GFP11 reporter constructs (TRAP1-GFP11-IRES-BFP, HMT2-GFP11-IRES-BFP or CS-GFP11-IRES-BFP) and 1.5 μg of empty vector construct using Lipofectamine 3000. Expression was induced by addition of doxycycline (1 μg ml–1) after 24 h. Flow cytometry was performed after another 24 h of incubation using a BD LSRFortessa instrument. Mitochondrial import was calculated as a function of the GFP+/BFP+ ratio in mScarlett+ cells. Gating strategies for flow cytometry analysis are shown in Supplementary Fig. 2.
Protein stability reporter assay
The pCS2+-degron-GFP-IRES-mCherry reporter constructs were generated as previously described21. The ISR reporter was designed as previously described23. All pCS2-degron-GFP-IRES-mCherry constructs are listed in Supplementary Table 4. A library of GFP-tagged candidate targets (associated with Fig. 2b) included proteins that are genetic and physical interactors of SIFI as well as proteins anticorrelated with SIFI subunits in proteomics analyses49 or across genetic screens (DepMap). Cells were seeded in 6-well plates at a density of 200,000 cells. The next day, 40 ng of reporter plasmid and empty vector up to 400 ng total were transfected into HEK293T cells on 6-well plates using PEI and collected for flow cytometry after 48 h. When siRNA depletions were carried out, 200,000 cells were seeded in 6-well plates. The next day siRNA transfections were performed using Lipofectamine RNAiMAX as described above. The following day, 50 ng of reporter and empty vector up to 500 ng total DNA were transfected using Lipofectamine 3000 according to the manufacturer’s instructions. After 24 h of reporter transfection, cells were collected and processed for flow cytometry. Cells were analysed using either a BD Bioscience LSR Fortessa or a LSR Fortessa X20, and the GFP/mCherry ratio was analysed using FlowJo. Gating strategies for flow cytometry analysis are shown in Supplementary Fig. 2.
Western blotting
For western blot analysis of whole cell lysates, cells were collected at indicated time points by washing in PBS, pelleting and snap freezing. Cells were lysed in lysis buffer (150 mM NaCl, 50 mM HEPES pH 7.5 and 1% NP-40 substitute) supplemented with Roche complete protease inhibitor cocktail (Sigma, 11836145001), PhosSTOP phosphatase inhibitor cocktail (Roche, 4906837001), carfilzomib (2 μM) and benzonase (EMD Millipore, 70746-4) on ice. Samples were then normalized to protein concentration using Pierce 660 nm Protein Assay reagent (Thermo Fisher, 22660). Next, 2× urea sample buffer (120 mM Tris pH 6.8, 4% SDS, 4 M urea, 20% glycerol and bromophenol blue) was added to the samples. SDS–PAGE and immunoblotting were performed using the indicated antibodies. Images were captured using a ProteinSimple FluorChem M device.
Small-scale immunoprecipitations
Cells were collected after washing in PBS, pelleted and snap frozen. Frozen pellets were resuspended in lysis buffer (40 mM HEPES pH 7.5, 100 mM NaCl, 0.1% NP40, with Roche complete protease inhibitor cocktail (Sigma-Aldrich, 11873580001), PhosSTOP phosphatase inhibitor cocktail (Roche, 4906837001), carfilzomib (2 μM, Selleckchem, S2853) and benzonase (EMD Millipore, 70746-4). Lysates were incubated for 20 min on ice and cleared by centrifugation for 20 min at 21,000g, 4 °C. Supernatants were normalized to volume and protein concentration, and 5% of the sample was removed as input and the sample was added to equilibrated anti-Flag-M2 Affinity Agarose Gel slurry (Sigma-Aldrich, A2220) and rotated for 1–2 h at 4 °C. Beads were washed 3× and eluted with 2× urea sample buffer. SDS–PAGE and immunoblotting were performed using the indicated antibodies. Images were captured using a ProteinSimple FluorChem M device.
His-ubiquitin immunoprecipitation
Five 15-cm plates of WT HEK293T or ΔUBR4 cells were transfected 2 days before collection with 2 μg of pcs2-HRI-3×Flag and 10 μg of pcs2-His-ubiquitin per 15 cm plate. Cells were treated with carfilzomib (2 μM) for 6 h, collected and flash frozen. Cells were lysed in 1 ml of 8 M urea lysis buffer (8 M urea, 300 mM NaCl, 0.5% NP-40, 50 mM Na2HPO4, 50 mM Tris-HCl pH 8, 10 mM imidazole, 10 mM N-ethylmaleimide (Sigma-Aldrich, E3876), with Roche complete protease inhibitor cocktail (Sigma-Aldrich, 11873580001), PhosSTOP phosphatase inhibitor cocktail (Roche, 4906837001), carfilzomib (2 μM, Selleckchem, S2853)) and incubated at room temperature for 20 min. Samples were sonicated at 20 Amp for 10 s (1 s on/1 s off). Samples were centrifuged at 15,000g for 15 min at room temperature and supernatants were normalized to volume and protein concentration. Next, 5% of the sample was removed as input and the sample was added to equilibrated Ni-NTA resin and rotated for 4 h at room temperature. Resin was washed twice with wash buffer (8 M urea, 300 mM NaCl, 50 mM Na2HPO4 and 50 mM Tris-HCl pH 8) containing 20 mM imidazole and once with wash buffer containing 40 mM imidazole, and eluted with Laemmli sample buffer containing 200 mM imidazole. SDS–PAGE and immunoblotting were performed using the indicated antibodies. Images were captured using a ProteinSimple FluorChem M device.
Antibodies
The following antibodies were used for immunoblot analyses: anti-Flag (mouse, clone M2, Sigma-Aldrich, F1804; dilution 1:1,000); anti-Flag (rabbit, Cell Signaling Technology (CST), 2368; dilution 1:1,000); anti-HA-tag (rabbit, C29F4, CST, 3724; dilution 1:1,000); anti-GAPDH (rabbit, D16H11, CST, 5174; dilution 1:1,000); anti-α-tubulin (mouse, DM1A, Calbiochem, CP06; dilution 1:1,000); anti-UBR4/p600 (rabbit, A302, Bethyl, A302-277A; dilution 1:1,000); anti-UBR4/p600 (rabbit, A302, Bethyl, A302-278A; dilution 1:1,000); anti-UBR4/p600 (rabbit, A302, Bethyl, A302-279A; dilution 1:1,000); anti-PKR (mouse, B-10, Santa Cruz, sc-6282; dilution 1:200); anti-GCN2 (mouse, F-7, Santa Cruz, sc-374609; dilution 1:200); anti-PERK (mouse, B-5, Santa Cruz, sc-377400; dilution 1:200); anti-UBE2A/B (mouse, G-9, Santa Cruz, sc-365507; dilution 1:150); anti-ATF4 (rabbit, D4B8, CST, 11815S; dilution 1:1,000); anti-EIF2AK1 (rabbit, Proteintech, 20499-1-AP; dilution 1:1,000), anti-SSBP1 (rabbit, Proteintech, 12212-1-AP; dilution 1:1,000); anti-TIM8A (rabbit, Proteintech, 11179-1-AP; dilution 1:500); anti-KCMF1 (rabbit, Sigma, HPA030383, dilution 1:1,000); anti-NIPSNAP3A (rabbit, Thermo Fisher, PA5-20657; dilution 1:1,000); anti-GADD34 (rabbit, Proteintech 10449-1-AP, dilution 1:1,000); anti-CReP (rabbit, Proteintech 14634-1-AP; dilution 1:1,000); anti-ubiquitin (rabbit, CST, 43124; dilution 1:1,000); goat anti-rabbit IgG (H+L) HRP (Vector Laboratories, PI-1000; dilution 1:5,000); sheep anti-mouse IgG (H+L) HRP (Sigma, A5906; dilution 1:5,000); and goat anti-mouse IgG light-chain-specific HRP conjugated (Jackson Immunoresearch, 115-035-174; dilution 1:5,000). The following antibodies were used for immunofluorescence: anti-TOM20 antibody (rabbit, Proteintech 11802-1-AP; dilution 1:500) and secondary antibody goat anti-rabbit AF647 (Thermo Fisher, A21245; dilution 1:500).
In vitro transcription/translation of substrates
In vitro synthesized substrates were all cloned into pCS2 vectors containing a SP6 promoter, as previously described50, and are summarized in Supplementary Table 4. The SUMO tag was appended to HRI and DELE1 for solubility. 35S-labelled substrates were generated by incubating 2.5 µg of plasmid DNA in 10 µl of wheat germ extract (Promega, L3260) supplemented with 2 µM carfilzomib and 1 µl of 35S-Met (PerkinElmer, NEG009H001MC) for 2 h at 25 °C. 35S-labelled substrates were used for in vitro ubiquitylation assays.
In vitro ubiquitylation assays
For in vitro ubiquitylation assays, human SIFI complex was purified using an endogenous Flag–UBR4 HEK293T cell line. Each in vitro ubiquitylation reaction required material from 2.5 15-cm plates of Flag–UBR4 cells. Frozen cell pellets were lysed at 4 °C for 30 min in 1 ml of lysis buffer per 10 15-cm plates (40 mM HEPES, pH 7.5, 5 mM KCl, 150 mM NaCl, 0.1% Nonidet P-40, 1 mM DTT, 1× complete protease inhibitor cocktail, 2 μM carfilzomib and 4 μl of benzonase per 10 15-cm plates). Lysed extracts were pelleted at 21,000g to remove cellular debris and the clarified lysate was bound to anti-Flag M2 resin (20 μl of slurry per 2.5 15-cm plates of material) for 2 h rotating at 4 °C. UBR4-coupled beads were washed 2× with detergent (40 mM HEPES, pH 7.5, 5 mM KCl, 150 mM NaCl, 0.1% Nonidet P-40, 1 mM DTT) and 2× without detergent (40 mM HEPES, pH 7.5, 5 mM KCl, 150 mM NaCl and 1 mM DTT). All liquid was removed from the beads using a crushed gel loading tip before addition of the in vitro ubiquitylation reaction.
In vitro ubiquitylation assays were performed in a 10 μl reaction volume: 0.5 μl of 10 μM E1 (250 nM final), 0.5 μl of 50 μM UBE2A (2.5 μM final), 0.5 μl of 50 μM UBE2D3 (2.5 μM final), 1 μl of 10 mg ml–1 ubiquitin (1 mg ml−1 final) (R&D Systems, U-100H), 0.5 μl of 200 mM DTT, 1.5 μl of energy mix (150 mM creatine phosphate (Sigma-Aldrich, 10621714001-5G), 20 mM ATP, 20 mM MgCl2, 2 mM EGTA, pH to 7.5 with KOH), 1 μl of 10× ubiquitylation assay buffer (250 mM Tris pH 7.5, 500 mM NaCl and 100 mM MgCl2), 0.5 μl of 1 mg ml–1 tandem ubiquitin binding entities (TUBEs) were pre-mixed and added to 10 μl of UBR4-coupled bed resin. Next, 3 μl of in vitro translated substrate or 1 μl of 100 µM TAMRA-labelled peptide was added to the reactions. Competitor proteins or peptides, or 1× PBS was added to reach final volume of 10 μl. Peptide sequences used in this study are summarized in Supplementary Table 7. Reactions were performed at 30 °C with shaking for 2 h. Reactions were stopped by adding 2× urea sample buffer and resolved on SDS–PAGE gels before autoradiography. TAMRA-labelled peptide ubiquitylation assays were run on 4–20% gradient gels (Thermo Fisher, EC6026BOX) and imaged using a ProteinSimple Fluorchem M imager. To test ubiquitin linkage specificity of SIFI, we used commercially available recombinant human ubiquitin mutants (R&D Systems, UM-K6R, UM-K11R, UM-K27R, UM-K29R, UM-K33R, UM-K48R, UM-K480, UM-K63R, UM-NOK, UM-K60, UM-K110, UM-K270, UM-K290, UM-K330 and UM-K630). E1 enzyme UBA1 was purified as previously described51. UBE2A, UBE2D3, TUBE, TOM20 WT and TOM20(I74S,V109S) recombinant proteins were purified as described below.
Recombinant protein purification
Human UBE2A and UBE2D3 were cloned into a pET28a His-tagged expression vector (pET28a-6×His-UBE2A, pET28a-6×His-UBE2D3) and were expressed in LOBSTR-BL21(DE3)-RIL cells. TUBEs were expressed from the pET28a-6×His-TEV-HALO-4×UbiquilinUBA in LOBSTR-BL21(DE3)-RIL cells. Protein expression was induced at OD600 = 0.6 with 250 μM IPTG for 16 h at 18 °C. Cells were lysed in lysis buffer (50 mM HEPES pH 7.5, 500 mM NaCl, 10 mM imidazole,10% glycerol, 5 mM BME, 1× PMSF (Sigma-Aldrich, P7626), 1 mg ml–1 lysozyme (Sigma-Aldrich, L6876-10G) and benzonase) by sonication. Lysates were clarified by centrifugation before 90 min of incubation with equilibrated Ni-NTA agarose beads (Qiagen, 20350). Beads were washed 3× in wash buffer (50 mM HEPES pH 7.5, 500 mM NaCl, 10% glycerol and 5 mM BME) with increasing concentration of imidazole (20 mM, 40 mM and 60 mM). Proteins were eluted in wash buffer and 250 mM imidazole and dialysed overnight using dialysis cassettes (Thermo Fisher, 66380) in storage buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 10% glycerol and 2 mM DTT). TEV protease (at 1 μg:100 μg TEV to protein ratio, UC Berkeley QB3 MacroLab) was added to the HALO-TEV-TUBEs during dialysis. The next day, TUBE protein was bound to equilibrated Ni-NTA agarose beads, and the flow-through was collected to remove TEV protease and uncleaved proteins. Dialysed proteins were concentrated using Amicon Ultra-4 3 K (UBE2A, UBE2D3) and 10 K (TUBEs) (Sigma-Aldrich, UFC800324, UFC801024), flash-frozen and stored at −80 °C for future use.
His-SUMO-TEV-TOM20(62–128) and His-SUMO-TEV-TOM20(62–128,I74S,V109S) were cloned into a pET28a His-tagged expression vector (pET28a-6×His-SUMO-TOMM20, pET28a-6×His-SUMO-TOMM20(I74S,V109S)) and were expressed in LOBSTR-BL21(DE3)-RIL cells. Protein expression was induced at log phase with 250 μM IPTG for 16 h at 18 °C. Cells were lysed in lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 10 mM imidazole, 5 mM BME and 1 mM PMSF) using a LM10 Microfluidizer. Lysate was clarified before 1 h of incubation with equilibrated Ni-NTA agarose beads, and beads were washed in wash buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 5 mM BME and 20 mM imidazole) and proteins were eluted in wash buffer containing 250 mM imidazole, dialysed overnight in dialysis cassettes in dialysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl and 5 mM BME) containing TEV protease (at 1 μg:100 μg TEV to protein ratio, UC Berkeley QB3 MacroLab). The next day, dialysed protein was bound to equilibrated Ni-NTA agarose beads, and the flow-through was collected to remove TEV protease and uncleaved proteins. The flow-through was run on a S75 column (50 mM HEPES pH 7.5, 150 mM NaCl and 1 mM TCEP). Fractions containing the proteins were run on Coomassie for validation, concentrated with Amicon Ultra-4 3 K, aliquoted, flash-frozen and stored at −80 °C for future use.
RNA-seq sample preparation and analysis
WT sgCNTRL, ΔUBR4 sgCNTRL, WT sgTIMM8A, ΔUBR4 sgTIMM8A, ISRIB-treated (200 nM, 16 h) ΔUBR4 sgTIMM8A and arsenite-treated (5 µM, 16 h) WT sgCNTRL and ΔUBR4 sgCNTRL cells were collected after washing in PBS, pelleted and snap-frozen. Three biological replicates were processed for each condition. Total RNA was extracted using a nucleospin RNA kit (Macherey-Nagel, 740955). Library preparation and deep sequencing were performed by Novogene. In brief, mRNA was purified from total RNA using polyT oligonucleotide attached magnetic beads. mRNA was fragmented and first-strand synthesis was performed with random hexamers followed by second-strand cDNA synthesis. This was followed by end repair, A-tailing, adapter ligation, size selection, amplification and purification. Libraries were sequenced by paired-end sequencing on an Illumina NovaSeq sequencer.
To obtain transcript abundance counts, sequencing reads were mapped to the human reference transcriptome (GRCh38, Ensembl Release 96) using Kallisto (v.0.48.0). Gene-level count estimates were obtained by summing counts or TPMs across all transcripts from a given gene. Differential gene-expression analysis was performed using DESeq2 (ref. 52) ran on the Galaxy server (Galaxy v.2.11.40.7)53 using the WT sgCNTRL as control for all samples. DESeq2 analysis results are provided in Supplementary Table 3. Genes with >1 TPM were retained for subsequent analysis. Genes significantly differentially expressed (P adjusted < 0.05), showing at least a twofold change, in the WT sgCNTRL cells treated with sodium arsenite were selected. Hierarchical clustering was performed in Custer (v.3.0)54 and results were visualized using Java Treeview55. HEK293T WT sgCNTRL and WT sgHRI treated with oligomycin from ref. 23 (NCBI Gene Expression Omnibus (GEO) identifier: GSE134986) were also clustered and used to isolate the upregulated ISR genes cluster. Raw and processed data have been deposited to the GEO under accession number GSE232191.
qPCR
Total RNA was purified using a nucleospin RNA kit (Macherey-Nagel, 740955). cDNA was generated using a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622) and RT–qPCRs were performed on a LightCycler 480 II Instrument (Roche) using 2× KAPA SYBR Fast qPCR master mix (Roche, KK4602). Fold changes in expression were calculated using the ΔΔCt method. qPCR primer sequences are presented in Supplementary Table 5.
Immunofluorescence and confocal microscopy
U2OS cells were seeded on 12-mm glass coverslips (Fisher Scientific, 1254580) at 100,000 cells per well in a 12-well plate. Cells were transfected the next day with pCS2-HRIhelix2-GFP-IRES-mCherry using Lipofectamine 3000. Medium was changed 24 h after transfection. At 48 h after transfection, cells were fixed in a solution of 4% paraformaldehyde in 1× dPBS for 20 min, followed by permeabilization with 0.3% Triton X-100 in 1× dPBS for 20 min, and finally blocked with 10% FBS in 1× dPBS for 30 min. Samples were probed with anti-TOM20 antibody (1:500) for 3 h in 1× dPBS, 10% FBS and 0.1% Triton X-100. Samples were incubated with secondary antibody goat anti-rabbit AF647 (1:500, Thermo Fisher, A21245) and stained with Hoechst 33342 (1:3,000, Anaspec, 83218) for 1 h. All sample processing was carried out at room temperature. Coverslips were mounted onto microscope slides with ProLong gold (Thermo Fisher, P36930) and imaged using a Zeiss LSM 900 with Airyscan 2 microscope. Images were captured with a ×63 oil objective and Airyscan SR. Images were processed using Zen Blue (Zeiss) Airyscan processing and Fiji.
Software and code for data analysis
The following freely or commercially available software and codes were used to analyse data: FlowJo (v.10.8.1), GraphPad Prism (v.9), ImageJ2 (v.2.9.0/1.53t), Cytoscape ClueGO (v.3.7.1), CasTLE (v.1.0), Kallisto (v.0.48.0), DESeq2 (Galaxy v.2.11.40.7), Cluster 3.0 and Java TreeView (v.1.1.6r4).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.