Strange India All Strange Things About India and world


Mice

C57BL/6N mice maintained under SPF or GF conditions were purchased from Sankyo Laboratories Japan, SLC Japan, Charles River Japan or CLEA Japan. Gnotobiotic mice were maintained within the gnotobiotic facility of RIKEN IMS. SPF and GF WT male and female mice (aged 8–12 weeks) were used in this study. Sex-matched littermates were used in all of the experiments. All of the animals were maintained under a 12 h–12 h light–dark cycle and received gamma-irradiated (50 kGy) pellet food (CMF, Oriental Yeast). A temperature of 20–24 °C and a humidity of 40–60% were used for the housing conditions. All of the animal experiments were approved by the Animal Care and Use Committee of RIKEN Yokohama Institute.

Collection of human faecal samples for trypsin-activity assays and for colonization of GF mice with human microbiota

Human faecal samples were collected at the RIKEN Institute (code H30-4, for patients with inflammatory bowel disease) and Keio University (code 20150075, for healthy donors) according to the study protocols approved by the institutional review boards. Informed consent was obtained from each participant.

Bacterial strains

P. clara JCM14859, P. xylaniphila JCM14860, Prevotella copri JCM13464, Prevotella denticola JCM13449, Prevotella stercorea JCM13469 and Prevotella oulorum JCM14966 were acquired from the Japan Collection of Microorganisms (JCM). P. clara P237E3b and P322B5 strains were derived from Vedanta Biosciences. P. xylaniphila 82A6 was a strain isolated at the Honda laboratory40. P. rara (DSM 105141), P. rodentium (DSM 105243) and P. muris (DSM 103722) were obtained from the DSMZ-German collection of Microorganisms and Cell Cultures. Bacterial strains are available under a contract with material transfer agreement with RIKEN.

Proteome analysis of caecal contents

Proteins in caecal contents were extracted by pipetting and inverting in TBST with protease inhibitors. After centrifugation at 15,000g for 20 min at 4 °C to remove insoluble matter, the supernatant was transferred to a new tube, 25% trichloroacetic acid was added (final concentration 12.5% (v/v)) and incubated for 1 h at 4 °C. After removing the supernatant by centrifugation at 15,000g for 15 min at 4 °C, the precipitate was washed twice with acetone and dried with the lid open. The dried sample was redissolved in 0.5% sodium dodecanoate and 100 mM Tris-HCl, pH 8.5 using a water-bath-type sonicator (Bioruptor UCD-200, SonicBio). The redissolved sample was assayed for protein concentration using the BCA assay and the protein concentration was adjusted to 1 μg μl−1. Pretreatment for shotgun proteome analysis was performed as previously reported14.

Peptides were directly injected onto a 75 μm × 15 cm, PicoFrit emitter (New Objective) packed in house with 2.7 μm core shell C18 particles (CAPCELL CORE MP 2.7 μm, 160 Å material; Osaka Soda) and then separated with a 180 min gradient at a flow rate of 300 nl min−1 using the Eksigent Ekspert NanoLC 400 HPLC system (Sciex). Peptides eluting from the column were analysed using the TripleTOF 5600+ mass spectrometer (Sciex) for both shotgun-MS and sequential window acquisition of all theoretical mass spectra (SWATH)-MS analyses. For shotgun-MS-based experiments, MS1 spectra were collected in the range of 400–1,000 m/z for 250 ms. The top 25 precursor ions with charge states of 2+ to 5+ that exceeded 150 counts per s were selected for fragmentation with a rolling collision energy, and MS2 spectra were collected in the range of 100–1,500 m/z for 100 ms. Dynamic exclusion time was set to 24 s. For SWATH-MS based experiments, the mass spectrometer was operated in a consecutive data-independent acquisition mode with 12 m/z increments in precursor isolation window. Using an isolation width of 13 m/z (1 m/z for the window overlap), a set of 50 windows was constructed covering the precursor mass range of 400–1,000 m/z. SWATH MS2 spectra were in the range of 100–1,500 m/z for 60 ms per MS2 experiment. Precursor ions were fragmented for each MS2 experiment using rolling collision energy.

All shotgun-MS files were searched against the mouse UniProt reference proteome (UP000000589; reviewed, canonical) using ProteinPilot software v.4.5 with the Paragon algorithm (Sciex) for protein identification. The protein confidence threshold was a ProteinPilot unused score of 1.3 with at least one peptide with 95% confidence. The global false-discovery rate for both peptides and proteins was lower than 1% in this study. The identified proteins were quantified from SWATH-MS data using PeakView v.2.2 (Sciex).

Proteome analysis of P. clara culture supernatant

Trichloroacetic acid (25%; final concentration 12.5% (v/v)) was added to the P. clara culture supernatant and incubated for 1 h at 4 °C. After removing the supernatant by centrifugation at 15,000g for 15 min at 4 °C, the precipitate was washed twice with acetone and dried with the lid open. The dried sample was redissolved in 0.5% sodium dodecanoate and 100 mM Tris-HCl, pH 8.5 by using a water-bath-type sonicator (Bioruptor UCD-200). The redissolved sample was assayed for protein concentration using the BCA assay, and the protein concentration was adjusted to 1 μg μl−1. The pretreatment for shotgun proteome analysis was performed as previously reported14. Peptides were directly injected onto a 75 μm × 20 cm PicoFrit emitter packed in house with 2.7 μm core shell C18 particles at 50 °C and then separated with an 80 min gradient at a flow rate of 100 nl min−1 using the UltiMate 3000 RSLCnano LC system (Thermo Fisher Scientific). Peptides eluting from the column were analysed using the Q Exactive HF-X (Thermo Fisher Scientific) system for overlapping window DIA-MS14,41. MS1 spectra were collected in the range of 495–785 m/z at 30,000 resolution to set an automatic gain control (AGC) target of 3 × 106 and a maximum injection time of 55. MS2 spectra were collected in the range of more than 200 m/z at 30,000 resolution to set an AGC target of 3 × 106, maximum injection time of ‘auto’ and stepped normalized collision energy of 22, 26 and 30 %. An isolation width for MS2 was set to 4 m/z and overlapping window patterns in 500–780 m/z were used window placements optimized by Skyline42.

MS files were searched against a P. clara spectral library using Scaffold DIA (Proteome Software). The spectral library was generated from P. clara protein sequence databases by Prosit43,44. The P. clara protein sequence database was independently created by metagenomic analysis. The Scaffold DIA search parameters were as follows: experimental data search enzyme, trypsin; maximum missed cleavage sites, 1; precursor mass tolerance, 8 ppm; fragment mass tolerance, 8 ppm; static modification, cysteine carbamidomethylation. The protein identification threshold was set with both peptide and protein false-discovery rates of less than 1%. Peptide quantification was calculated using the EncyclopeDIA algorithm45 in Scaffold DIA. For each peptide, the four highest-quality fragment ions were selected for quantification. Protein quantification was estimated from the summed peptide quantification.

Peptidome analysis

To the caecal contents, acetonitrile containing 0.1% TFA was added and dried in a centrifugal evaporator. Acetone was added to the dried sample and lipid-soluble small molecules were extracted with a water-bath-type sonicator, followed by centrifugation at 15,000g for 15 min at 4 °C. After the supernatant was removed, 70% acetonitrile-12 mM HCl46 was added to the precipitate and the peptide was redissolved by a water-bath-type sonicator, followed by centrifugation at 15,000g for 15 min at 4 °C. The supernatant was transferred to a new tube and dried in a centrifugal evaporator. The dried sample was redissolved in 100 mM Tris-HCl and protease inhibitors, and treated with 10 mM dithiothreitol at 50 °C for 30 min. Subsequently, the sample was alkylated with 30 mM iodoacetamide in the dark at room temperature for 30 min and acidified with 0.5% trifluoroacetic acid (final concentration). The acidified sample was desalted by Monospin C18 (GL Sciences).

Peptides were directly injected onto a 75 μm × 25 cm PicoFrit emitter (New Objective) packed in-house with C18 core-shell particles (CAPCELL CORE MP 2.7 μm, 160 Å material; Osaka Soda) at 50 °C and then separated with a 90 min gradient at a flow rate of 100 nl min−1 using an UltiMate 3000 RSLCnano LC system (Thermo Fisher Scientific). Peptides eluting from the column were analysed using the Q Exactive HF-X (Thermo Fisher Scientific) for DDA-MS. MS1 spectra were collected in the range of 380 to 1,500 m/z with 120,000 resolution to hit an AGC target of 3 × 106. The 30 most intense ions with charge states of 2+ to 8+ that exceeded 4.4 × 103 were fragmented in data-dependent mode by collision-induced dissociation with stepped normalized collision energy of 21%, 25% and 29%, and tandem mass spectra were acquired on the Orbitrap mass analyser with a mass resolution of 30,000 at 200 m/z to set an AGC target of 2 × 105.

MS files were searched against the mouse UniProt reference proteome (UP000000589; reviewed, canonical) by PEAKS Studio. The search parameters were as follows: precursor mass tolerance, 8 ppm; fragment ion mass tolerance, 0.01 Da; enzyme, no enzyme; fixed modifications, carbamidomethylation; variable modifications, oxidation (M). The peptide identification was filtered to a peptide false-discovery rate of less than 1%.

In-gel digestion and LC–MS/MS analysis

The protein bands were excised, and in-gel digestion was performed as previously described47. The digested peptides were directly injected onto a 75 μm × 12 cm PicoFrit emitter (New Objective) at 40 °C and then separated with a 30 min gradient at a flow rate of 200 nl min−1 using the UltiMate 3000 RSLCnano LC system (Thermo Fisher Scientific). Peptides eluted from the column were analysed on the Q Exactive HF-X (Thermo Fisher Scientific) system for DDA-MS. MS1 spectra were collected in the range of 380 to 1,240 m/z with 120,000 resolution to hit an AGC target of 3 × 106. The 20 most intense ions with charge states 2+ to 5+ were data-dependently dissociated by collision-induced dissociation with step-normalized collision energies of 22%, 26% and 30%, and tandem mass spectra were acquired on the Orbitrap mass analyser with 30,000 resolution to set an AGC target of 1 × 105.

MS files were searched against the P. clara protein sequence database with human PRSS2 sequence (UniProt: P07478) using PEAKS Studio. The search parameters were as follows: precursor mass tolerance, 8 ppm; fragment ion mass tolerance, 0.01 Da; enzyme, trypsin; variable modifications, oxidation (M). Peptide and protein identifications were filtered so that both peptide and protein false discovery rates were less than 1%.

Western blot analysis

Mouse caecal and faecal samples were suspended and diluted 50-fold in PBS supplemented with a protease inhibitor cocktail (Roche cOmplete, Mini, EDTA-free). Resuspended samples were centrifuged at 4 °C, 15,000g for 10 min, and the supernatant was collected for western blotting. Mouse pancreatic tissues were snap-frozen in liquid nitrogen and the proteins were extracted using TRIzol Reagent (Thermo Fisher Scientific), and the final protein concentration was adjusted to 4 μg μl−1. For SDS–PAGE and blotting, the Novex NuPAGE SDS–PAGE Gel system (Thermo Fisher Scientific) and iBlot 2 Dry Blotting System (Thermo Fisher Scientific) were used according to the manufacturer’s instructions. In some earlier experiments, SDS–PAGE and PVDF membrane (0.2 μm Transfer Membranes Immobilon-PSQ, Merck Millipore) transfer were performed according to the manufacturer’s (XV Pantera System (DRC)) instructions. iBind Western Systems (Thermo Fisher Scientific) were used for staining throughout the study. The antibodies used in this study are as follows: rabbit anti-mouse PRSS2 (Cosmo Bio, CPA, Japan, custom-made), rabbit anti-mouse HSP90 antibody (4877, C45G5, Cell Signaling Technology), rabbit anti-human PRSS2 (LS-B15726, LSBio), rabbit anti-human PRSS1 (LS-331381, LSBio), rabbit anti-mouse TMPRSS2 (LS-C373022, LSBio, raised against a sequence at the protease domain), rabbit anti-6-His (A190-214A, Bethyl laboratories, to probe His-tagged recombinant mouse PRSS2 (rmPRSS2) and human PRSS3 (rhPRSS3)), goat anti-mouse IgA alpha-chain (HRP) (ab97235, Abcam), rat anti-mouse kappa-chain (HRP) (ab99632, Abcam), rabbit anti-mouse CELA3b (OACD03205, Avivasysbio), anti-rabbit IgG (HRP-linked antibody) (7074, Cell Signaling Technology), rabbit anti-mouse Reg3β (51153-R005, Sino Biological). Rabbit anti-6-His antibodies (A190-214A, Bethyl laboratories) were used to probe rmPRSS2 throughout the study except for the experiment in Fig. 3j, for which rabbit anti-mouse PRSS2 (Cosmo Bio, CPA, custom-made) was used to differentiate rmPRSS2 from recombinant 00502 and 00509 (also His-tagged). For staining, a 1:400 dilution was used for all the primary antibodies and secondary antibodies. Chemi-Lumi One (nacalai tesque) was used for the chemiluminescence assays and the Molecular imager ChemiDoc XRS+ (BIO-RAD) or iBright FL1500 system was used for imaging. Full scans of all of the blots are provided in Supplementary Fig. 1.

RT–qPCR

RNA from mouse pancreas, small intestine and colon organoids was extracted by TRIzol Reagent (Thermo Fisher Scientific). Extracted RNA was converted to cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). RT–qPCR analysis was conducted with the Thunderbird SYBR qPCR Mix (Toyobo) and Lightcycler480 v.1.5.1 (Roche) software and analysed using the ΔΔCt method or using a standard curve generated from serial dilutions of pooled cDNA (for Tmprss2, Ceacam1 and Actb). Gapdh and Actb were used as the endogenous control. Primer sequences were as follows: Gapdh forward primer, 5′-GTCGTGGAGTCTACTGGTGTCTTC-3′; Gapdh reverse primer, 5′-GTCATATTTCTCGTGGTTCACACC-3′; Prss2 forward primer, 5′-TGTGACCCTCAATGCCAGAG-3′; Prss2 reverse primer, 5′-AGCACTGGGGCATCAACAC-3′; Tmprss2 forward primer, 5′-AACGCAAGCCTCAACATCTG-3′; Tmprss2 reverse primer, 5′-AACCTCCAAAGCAAGACAGC-3′; Ceacam1 forward primer, 5′-GCCTGGCTTAGCAGTAGTGT-3′; Ceacam1 reverse primer, 5′-CCAGGAGGCTAAAAGTGAGG-3′; Actb forward primer, 5′-TTGCTGACAGGATGCAGAAG-3′; Actb reverse primer, 5′-ATCCACATCTGCTGGAAGGTG-3′.

Immunofluorescence

Mouse colon tissues (containing faecal pellet) were sampled and fixed with Cornoy solution (60% methanol, 30% chloroform, 10% glacial acetic acid) at 4 °C overnight. A tissue processor (Leica Microsystems) was used for paraffin embedding. Paraffin blocks were processed into thin sections (5.0 μm) using a microtome, followed by paraffin removal and immunostaining. The antibodies and stains used for immunofluorescence were as follows: rabbit anti-PRSS2 (LSBio, LS-C296077, 1:100), Alexa 488-labelled goat anti-rabbit IgG (Thermo Fisher Scientific, A11008, 1:1,000), 4′-6-diamidino-2-phenylindole (DAPI, DOJINDO), rhodamine-labelled UEA1 (Ulex Europaeus Agglutinin 1, Vector Laboratories). The Leica AF600 and confocal Leica TCS SP5 systems were used for immunofluorescence imaging.

Trypsin-activity assay of mouse and human faecal samples

Mouse intestinal luminal contents or faecal samples were diluted 500-fold (w/v) in 0.9% NaCl solution. Human faecal samples were diluted 200-fold (w/v) in 0.9% NaCl solution. The diluted solutions were vortexed with a mini-shaker for 20 min at 2,000 rpm, homogenized by pipetting and centrifuged at 4 °C and 10,000g for 15 min. The supernatant was collected for trypsin-activity assay using the Trypsin Activity Assay Kit (Colorimetric) (ab102531) according to the manufacturer’s protocol. Absorbance at 405 nm was measured using the PerkinElmer 2030 Multilabel Reader in kinetic mode.

Colonization of GF mice with human microbiota

Human faecal samples (preserved in 20% (v/v) glycerol) were transferred to an anaerobic chamber, thawed and sieved through 100 μm meshes, transferred into a GF isolator and introduced into GF mice by oral gavage (200 μl per mouse). For antibiotics treatment, 0.5 g l−1 ampicillin (nacalai tesque), 0.5 g l−1 metronidazole (nacalai tesque) and 1.0 g l−1 tylosin (Sigma-Aldrich) solutions were made using autoclaved tap water. Mice receiving oral gavage of the caecal contents from the donor-C-microbiota-colonized mouse were fed with antibiotic solutions for 12 days. Antibiotic solutions were replaced once per week.

Isolation and identification of colonized species from mouse caecal contents

Mouse caecal contents were mixed with glycerol-containing (20%) PBS in an anaerobic chamber and stocked at −80 °C. An aliquot was diluted with TS broth (BD) in an anaerobic chamber and plated onto different agar plates: EG, ES, M10, NBGT, VS, TS (BD), BL (Eiken Chemical), BBE (Kyokuto Seiyaku), Oxoid CM0619 (Thermo Fisher Scientific), CM0619-supplemented SR0107 (Thermo Fisher Scientific), CM0619-supplemented SR0108 (Thermo Fisher Scientific), mGAM (NISSUI-Pharm) and Schaedler (BD). After incubation for 2 days, colonies with different appearances were transferred to new EG plates. Colonies were then incubated in EGEF liquid medium overnight, mixed with glycerol (final concentration 20% (v/v)) and stocked at −80 °C.

The formula of EG (Eggerth Gagnon) agar plates is as follows: protease peptone no. 3 (10.0 g), yeast extract (5.0 g), Na2HPO4 (4.0 g), glucose (1.5 g), soluble starch (0.5 g), l-cysteine HCl (0.5 g), l-cystine (0.2 g), Tween-80 (0.5 g), agar (4.8 g), horse meat extract (500 ml), water up to 1,000 ml + defibrinated horse blood (50 ml). EGEF medium was the same, except with no agar and defibrinated horse blood (50 ml) was replaced with Fildes solution (40 ml).

The bacterial DNA genome was extracted from the isolated strains using the same protocol as DNA isolation from faecal samples (below). 16S rRNA was amplified by PCR using the KOD plus Neo (TOYOBO) kit according to the manufacturer’s protocol. Sanger sequencing was performed by Eurofins. Sequences were blasted against NCBI database. Primers for Sanger sequencing were as follows: F27 primer, 5′-AGRGTTTGATYMTGGCTCAG-3′; R1492 primer, 5′-TACGGYTACCTTGTTACGACTT-3′.

16S rRNA sequencing

Frozen mouse faecal samples were thawed and 100 µl of the suspensions was mixed with 900 µl TE10 (10 mM Tris-HCl, 10 mM EDTA) buffer containing RNase A (final concentration 100 µg ml−1, Invitrogen) and lysozyme (final concentration 3.0 mg ml−1, Sigma-Aldrich). The suspension was incubated for 1 h at 37 °C with gentle mixing. Purified achromopeptidase (Wako) was added to a final concentration of 2,000 U ml−1 and the sample was further incubated for 30 min at 37 °C. Sodium dodecyl sulfate (final concentration 1%) and proteinase K (final concentration 1 mg ml−1, Nacalai) were then added to the suspension and the mixture was incubated for 1 h at 55 °C. High-molecular-mass DNA was extracted by phenol:chloroform:isoamyl alcohol (25:24:1), precipitated by isopropanol, washed with 70% ethanol and resuspended in 100 µl of TE. PCR was performed using Ex Taq (Takara) and the 27Fmod primer (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCTAGRGTTTGATYMTGGCTCAG-3′) and the 338R primer (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCTGCCTCCCGTAGGAGT-3′) to the V1–V2 region of the 16S rRNA gene (where XXXXXXXX represents the Miseq (Illumina) Index sequence). The PCR product was purified with Agencourt AMPure XP (Beckman Coulter) according to the manufacturer’s protocol. The 16S rRNA library was created using the Kapa library quantification Kit (Kapa Biosystems) according to the manufacturer’s protocol. 16S rRNA sequencing was conducted using the standard protocol of MiSeq Reagent kit v.3. The obtained 16S rRNA sequencing data were analysed as previously described48. UCLUST (https://www.drive5.com/) was used to construct OTUs. Taxonomy was assigned to each OTU by searching against the National Center for Biotechnology Information (NCBI) using the GLSEARCH program.

Gnotobiotic studies and quantification of faecal bacterial DNA

With the exception of Phascolarctobacterium faecium (3G4), isolated bacterial strains were incubated in EGEF in an anaerobic chamber at 37 °C for 1–2 days. P. faecium was incubated on Oxoid CM0619 agar plates supplemented with 80 mM succinic sodium for 2–3 days, and colonies were collected and resuspended in EGEF. Bacterial density was adjusted on the basis of optical density at 600 nm (OD600) values and mixtures of the cultured strains were administered into GF mice (150 µl per mouse, approximately 1–2 × 108 colony-forming units (CFU) of total bacteria) by oral gavage. For quantification of faecal DNA of P. clara, P. merdae, B. uniformis, P. rodentium and P. muris, mouse faecal DNA was purified and qPCR was performed to amplify a sequence specific to respective bacterial 16S rRNA gene using the Thunderbird SYBR qPCR Mix (Toyobo) on the LightCycler 480 System (Roche). For quantification of faecal DNA of the WT or Δ00502 P. clara, qPCR was carried out to amplify a sequence specific to the 00502 gene (for the WT) or a sequence spanning the upstream and downstream fragment of the 00502 gene (for Δ00502). Standard curves were generated from serial dilutions of bacterial genomic DNA purified from in vitro bacterial cultures of the respective strains. For analyses of the total faecal bacterial DNA, a universal bacterial 16S rRNA gene primer pair was used49. A list of all of the primers used for faecal bacterial DNA quantification is provided in Supplementary Table 5.

Bacterial whole-genome sequencing

Genomic DNA was extracted from the isolated bacteria including the P. clara 1C4 strain and sheared to yield DNA fragments. Bacterial genome sequencing was performed using the whole-genome shotgun strategy supported by the PacBio Sequel and Illumina MiSeq sequencing platforms. The TruSeq DNA PCR-Free kit was used to prepare the library of the Illumina Miseq 2 × 300 bp paired-end sequencing with target length of 550 bp, and the FASTX-toolkit (http://hannonlab.cshl.edu/fastx_toolkit) was used to trim and filter all of the MiSeq reads with a >20 quality value. The SMRTbell template prep kit 2.0 was used to generate the library of the PacBio Sequel sequencing with a target length of 10–15 kb without DNA shearing. Error correction of the trimmed reads was conducted by Canu (v.1.8) with additional options (corOutCoverage = 10,000, corMinCoverage = 0, corMhapSensitivity = high) after internal control removal and adapter trimming by Sequel. De novo hybrid assembly of the filter-passed MiSeq reads and the corrected Sequel reads was performed by Unicycler (v.0.4.8), including a check of overlapping and circularization, and a circular contig was generated. The Rapid Annotations based on Subsystem Technology (RAST) server and Prokka software tool were used for gene prediction and annotation of the generated contig. The default parameters were used for all software unless specified otherwise.

C. rodentium vaccination and infection

GF mice were pre-inoculated with 200 μl of 2-mix (B. uniformis 3H3 and P. merdae 1D4) + WT or Δ00502 P. clara and maintained for 4 days. The mice were then orally administered peracetic-acid-inactivated C. rodentium (1010 per mouse) once per week for three weeks. After three weeks of immunization, the mice were infected with an overnight culture of C. rodentium (150 µl per mouse) by oral gavage and euthanized on day 14 after infection. Peracetic-acid-inactivated C. rodentium was generated as previously described30. In brief, overnight cultures of C. rodentium were collected by centrifugation (16,000g, 10 min) and resuspended at a density of 1010 per ml in sterile PBS. Peracetic acid (240990, Sigma-Aldrich) was added to the bacterial suspension (final concentration, 0.4%) and incubated for 1 h at room temperature. After washing three times with sterile PBS, the final pellet was resuspended at a final concentration of 1011 particles per ml in PBS and stored at 4 °C. The vaccine was tested before use by inoculating 100 µl of the inactivated vaccine into 200 ml LB medium and incubating overnight at 37 °C to ensure complete inactivation. For the CFU assay, caecal patches or caecal luminal contents were collected and homogenized in PBS, and serially diluted homogenates were plated on LB agar plates. CFUs were counted after overnight incubation at 37 °C under aerobic conditions. For ex vivo evaluation of C. rodentium-specific IgA, caecal contents were diluted fivefold (w/v) in LB medium, centrifuged and the supernatant was filtered with sterile filter units with PVDF membranes (0.22 µm pore size) before being mixed with equal volumes of an in vitro overnight C. rodentium culture. The mixture was incubated at room temperature with gentle shaking for 1 h, and the agglutination effect was examined using a confocal microscope (Leica TCS SP8). Alternatively, after incubation, the mixture was centrifuged, washed once with PBS and the bacterial pellets were lysed with 1% SDS solution (in 50 mM Tris-HCl buffer supplemented with 5 mM EDTA). The lysates were stained with goat anti-mouse IgA alpha-chain (HRP) antibodies (ab97235) by western blotting to evaluate the amount of C. rodentium-binding (C. rodentium-specific) IgA in the caecal contents.

MHV-2 infection in vivo

MHV-2 was propagated in DBT cells as previously reported4. GF C57BL/6N male mice (aged 5 weeks) were obtained from CLEA Japan or Sankyo Labo Service and housed in separate stainless-steel isolators. GF mice were orally inoculated with 200 μl of 2-mix (B. uniformis 3H3 and P. merdae 1D4) + WT P. clara or 2-mix+Δ00502 P. clara, or 34-mix+WT P. clara or 34-mix+Δ00502 P. clara. Two weeks after inoculation, the mice were infected with 4.5 × 106 plaque-forming units of MHV-2 through intragastric gavage using a long (4 cm) catheter, and survival was monitored daily for 10 days. To detect and quantify MHV-2, the livers and brains were collected at day 4 or day 5 after infection and homogenized in DNA/RNA shield (Zymo Research). Viral RNA was extracted using the Quick-RNA Viral Kit (Zymo Research) according to the manufacturer’s instructions, and cDNA was synthesized using ReverTra Ace (TOYOBO) and random primers (TOYOBO). qPCR was performed to amplify a fragment in the 5′ region of viral ORF1a (5′-AAGAGTGATTGGCGTCCGTAC-3′ and 5′-ATGGACACGTCACTGGCAGAG-3′) using the THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a LightCycler 480 System (Roche). The quantity of MHV-2 was calculated on the basis of a standard curve generated using a plasmid with a predetermined copy number inserted with the cDNA of a 5′ region (175 bp) of viral ORF1a. For histological examination, the livers were collected at day 5 after infection and fixed with 4% paraformaldehyde overnight at 4 °C. H&E staining was performed at the Pathology Analysis Center, Central Institute for Experimental Animals (CIEA). In brief, fixed tissue was embedded in paraffin, serially sectioned at a thickness of 5 μm and stained with H&E. The images were captured with the BX-X800 microscope (Keyence).

Organoid culture and MHV-2 infection

Mouse small intestine and colon organoids were established as previously described50,51. In brief, intestine tissues were opened longitudinally, washed with ice-cold PBS, cut into small pieces and subsequently treated with 5 mM EDTA on a rocking shaker for 30 min at 4 °C. After the supernatant was carefully removed, the remaining tissue was washed with PBS by pipetting up and down, followed by passed through 70 μm cell strainers, and centrifuged at 300g for 3 min. Isolated crypts were embedded in Matrigel (Corning) and cultured with organoid growth medium, as follows: Advanced DMEM/F-12 (Gibco) supplemented with 10 mM HEPES, 2 mM GlutaMAX, 100 U ml−1 penicillin, 100 μg ml−1 streptomycin, 20% Afamin/Wnt3a CM (MBL), 50 ng ml−1 mouse recombinant EGF (Gibco), 100 ng ml−1 mouse recombinant noggin (Peprotech), 1 μg ml−1 human recombinant R-spondin 1 (R&D Systems), 500 nM A 83-01 (Tocris), 1× N2 supplement (Gibco), 1× B-27 supplement (Gibco) and 1 mM N-acetyl-l-cysteine (Sigma-Aldrich). The organoids were passaged mechanically every 4–5 days.

Before MHV-2 infection, organoids and MDCK cells (ATCC, CCL-34, mycoplasma-free) were dissociated into single cells using TrypLE express. A total of 2 × 105 cells was infected at a multiplicity of infection of 1 for 2 h at 37 °C under 5% CO2 in the presence or absence of 1 μg ml−1 bovine trypsin that was treated with l-1-tosylamido-2-phenylethyl chloromethyl ketone to inhibit contaminating chymotrypsin activity without affecting trypsin activity (Thermo Fisher Scientific). After infection, cells were washed twice with DMEM/F-12, embedded in Matrigel in a 48-well tissue culture plate and cultured in organoid growth medium at 37 °C with 5% CO2. Each well contained 2 × 104 cells. At 24 h after plating, the samples were collected and suspended in DNA/RNA shield. The viral RNA copy number was determined as described above.

In vitro degradation of trypsin

Overnight bacterial cultures were incubated with recombinant mouse trypsin (final concentration 1 µg ml−1) for 1 h or human trypsin (final concentration 20 µg ml−1) for 4 h. The recombinant trypsin isoforms used in this study were as follows: mouse recombinant PRSS2 (50383-M08H, Sino Biological), human recombinant PRSS1 (LS-G135640), human recombinant PRSS2 (LS-G20167) and human recombinant PRSS3 (His-tag) (NBP2-52220). In some experiments, recombinant mouse PRSS2 was first treated with one of the following trypsin inhibitors for 30 min before incubation with P. clara: AEBSF (Sigma-Aldrich; final concentration, 2 mM), Leupeptin (Sigma-Aldrich; final concentration, 100 µM) and TLCK (Abcam; final concentration, 100 µM). In some of the experiments P. clara was grown overnight in the presence of tunicamycin (Sigma-Aldrich; final concentration, 10 µg ml−1), 2-fluro-l-fucose (Cayman Chemical; final concentration, 250 µM) or DMSO control before incubation with recombinant mouse PRSS2. For the experiments assessing the effect of Ca2+, P. clara was grown in a low-Ca2+ mGAM medium with or without supplementation with 1 mM Ca2+ before incubation with mouse recombinant PRSS2. For experiments using P. clara supernatant, the P. clara overnight culture was filtered with a sterile filter unit with a PVDF membrane (0.22 µm pore size).

Confocal microscopy

Recombinant mouse PRSS2 was labelled with Alexa Fluor 488 using Alexa Fluor 488 Antibody Labeling Kit (A20181, Thermo Fisher Scientific) and pretreated with AEBSF inhibitor (150 µg ml−1 rmPRSS2 with 20 mM AEBSF). Alexa Fluor 488-labelled mouse PRSS2 was incubated with overnight bacterial cultures at a final concentration of 5 µg ml−1 for 20 min in an anaerobic chamber. The mixture was centrifuged, washed with PBS once and resuspended in PBS. Leica TCS SP8 confocal microscopy was used for confocal imaging.

DSSO cross-linking

DSSO (A33545) was purchased from Thermo Fisher Scientific. P. clara 1C4 was incubated with AEBSF-pretreated recombinant mouse recombinant PRSS2 (50383-M08H, Sino Biological) for 20 min, washed once with PBS and resuspended in 10 mM DSSO. The reaction was incubated at room temperature for 10 min and quenched by adding concentrated Tris-HCl buffer (final concentration, 20 mM). After washing with PBS, the pellet was lysed with 1% SDS solution (in 50 mM Tris-HCl buffer supplemented with 5 mM EDTA). P. clara 1C4 without incubation with PRSS2 was processed in the same manner to serve as the negative control. Lysates were stained with rabbit anti-6-His antibodies (A190-214A, Bethyl laboratories) and anti-rabbit IgG (HRP-linked antibody) (7074, Cell Signaling Technology) and analysed by western blot.

Protein staining of whole-cell lysate, supernatant and glycan-containing proteins

P. clara 1C4 was cultured overnight in the presence of Tunicamycin (Sigma-Aldrich; final concentration, 10 µg ml−1), 2-fluro-l-fucose (Cayman Chemical; final concentration, 250 µM) or DMSO control. Cultured bacteria were then pelleted, washed once with PBS and lysed with 1% SDS solution (in 50 mM Tris-HCl buffer supplemented with 5 mM EDTA). SDS–PAGE was conducted using the Novex NuPAGE SDS–PAGE Gel system (Thermo Fisher Scientific). Glycan-containing proteins were stained with the Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. The protein contents of the whole-cell lysates were stained using the Colloidal Blue Staining kit (Thermo Fisher Scientific). Supernatant proteins were first condensed using Amicon Ultra Centrifugal Filters (10 kDa NMWL) and then stained using the Colloidal Blue Staining kit (Thermo Fisher Scientific).

Mutant generation

The deletion mutants (Δ03049-03053, Δ00502 and Δ00509) of P. clara JCM14859 were generated as previously described30 with minor modifications. In brief, approximately 1 kb sequences flanking the coding region were amplified by PCR and assembled into the suicide vector pLGB30 using HiFi DNA Assembly (NEB) according to the manufacturer’s protocol. Aliquots of each reaction (1 μl) were transformed into electrocompetent Escherichia coli S17-1 λpir. Transformants were conjugated with P. clara JCM14859 as follows. The donor and recipient strains were cultured in LB and EGEF media, respectively, to an OD600 of 0.5 and mixed at a ratio of 1:1. The mixture was dropped onto an EGEF agar plate and incubated aerobically at 37 °C for 16 h. Transconjugants were selected on EGEF agar plates containing tetracycline (10 μg ml−1). Transconjugants were partially sensitive to rhamnose-induced ss-bfe1 toxin expression and, in the presence of 10 mM rhamnose, their growth was inhibited (with an overnight OD600 of ~0.3). Subsequently, to select for loss of the plasmid from the genome by a second crossover, transconjugants were cultured in EGEF broth supplemented with 10 mM rhamnose for at least three generations until the transconjugants were outcompeted by the revertants (overnight OD600 reached ~1.0). The bacterial culture was then plated, single colonies were picked and successful deletions were confirmed by PCR. For generation of insertional mutants, a similar protocol was used: approximately 0.5–1 kb homologous sequences of the coding regions were assembled into the suicide vector pLGB30 and transformed into electrocompetent E. coli S17-1 λpir. Transformants were conjugated with P. clara JCM14859 using the same protocol and transconjugants were selected on EGEF agar plates containing tetracycline (10 μg ml−1), confirmed by PCR and maintained in EGEF broth supplemented with tetracycline (10 μg ml−1). A list of all of the primers used for mutagenesis is provided in Supplementary Table 5.

Transmission electron microscopy

WT or Δ00502 P. clara JCM14589 strains were incubated with mouse recombinant PRSS2 (50383-M08H, Sino Biological; final concentration, 5 µg ml−1) for 20 min, washed with PBS and fixed with 4% paraformaldehyde-1% glutaraldehyde solution at room temperature for 2 h. After washing with 0.05 M PBS, the pellets were dehydrated in a graded series of ethanol (50%, 70%, 80%, 90%, 95% and 100%). The dehydrated pellets were infiltrated with LRW resin (1:1 of 100% ethanol and LRW for 1 h, then 1:2 of 100% ethanol and LRW overnight, and then 100% LRW for 5 h). After infiltration, the samples were cured in gelatin capsules (53 °C for 24 h). Polymerized LRW blocks were sectioned using the Leica Ultracut UCT and 80 nm sections were obtained. For immunogold staining, sections were first blocked with 0.05 M PBS supplemented with 1% BSA, followed by staining with rabbit anti-6-His antibodies (A190-214A, Bethyl laboratories) for 60 min. After washing with 0.05 M PBS, the sections were stained with 12 nm Colloidal Gold goat anti-rabbit IgG for 60 min. After washing again with 0.05 M PBS, the sections were fixed with 1% glutaraldehyde in 0.05 M PBS, washed with H2O and stained with uranyl acetate for 5 min. All of the images were taken using the JEOL JEM-1400 transmission electron microscope.

Recombinant protein expression, coupling to magnet microbeads and blue native gel electrophoresis

For generation of recombinant 00502 and 00509, the coding regions of both genes (excluding the N-terminal sequences encoding the signal peptides) were cloned into the expression vector pET-28b (+) (Novagen, 69865) to introduce a C-terminal His-tag according to the supplier’s protocol. Expression vectors were transformed into Rosetta-gami B(DE3) competent cells (Novagen, 71136). Transformants were grown to the exponential phase and protein expression was induced by supplementation with 0.4 mM IPTG (Sigma-Aldrich, I6758). After overnight culture at 25 °C, cells were lysed with the B-PER Bacterial Protein Extraction Reagent (Thermo Fisher Scientific, 78243), and recombinant 00502 and 00509 were purified with the Pierce Ni-NTA Magnetic Agarose Beads (Thermo Fisher Scientific, 78605) and Pierce Polyacrylamide Spin Desalting Columns (Thermo Fisher Scientific, 89849). Purified recombinant 00502 and 00509 or bovine serum albumin (Thermo Fisher Scientific, 23209) were coupled to the micromagnetic beads (Dynabeads) with the Dynabeads Antibody Coupling kit (Thermo Fisher Scientific, 14311D) according to the manufacturer’s protocol, with 15 μg protein input per mg of beads. For downstream analyses, 1 mg protein-coupled Dynabeads was resuspended in 200 μl EGEF medium and mixed with recombinant mouse PRSS2 (final concentration 3 µg ml−1), AEBSF-pretreated Alexa Fluor 488-labelled recombinant mouse PRSS2 (final concentration 5 µg ml−1) or 50 μl GF caecal contents (50-fold dilution in PBS). For blue native gel electrophoresis, recombinant 00502 and 00509 were purified with anion-exchange and nickel-affinity chromatography from r00502- or r00509-expressing Rosetta-gami B(DE3) E. coli. The Native PAGE Bis-Tris Gel System (Thermo Fisher Scientific, BN1002BOX and BN2007) was used according to the manufacturer’s protocol. To detect the r00502–trypsin complex, 100 µg ml−1 or 400 µg ml−1 recombinant human PRSS2 was pretreated with 20 mM AEBSF trypsin inhibitor for 30 min, incubated with r00502 (100 µg ml−1) and then loaded to native PAGE gels. SERVANativ Marker Liquid Mix (SERVA, 39219) was used as the protein standard. For western blot analysis of blue native gels, proteins were blotted using the iBlot 2 Dry Blotting System with PVDF membranes (Thermo Fisher Scientific). A list of the primers used for the generation of the recombinants is provided in Supplementary Table 5.

Protease activity assay

The Pierce Fluorescent Protease Assay Kit (Thermo Fisher Scientific, 23266) was used to determine the protease activity of the P. clara culture, the P. clara culture supernatant, and recombinant 00502 and 00509 according to the manufacturer’s protocol. The PerkinElmer 2030 Multilabel Reader with fluorescein excitation and emission filters (485/538 nm) was used to detect increased total fluorescence as the fluorescein isothiocyanate (FITC)–casein substrate was digested by proteases into smaller fluorescein-labelled fragments. Protease activity was expressed as change in relative fluorescence units (RFU).

Ex vivo degradation of IgA by faecal and recombinant trypsin

Faeces from the 2-mix+WT P. clara-colonized mice and GF mice was filtered to remove the bacteria, diluted 50-fold in PBS, mixed at a ratio of 1:1 (in the presence or absence of 100 µM trypsin inhibitor TLCK) or mixed with an equal volume of PBS (final dilution 100-fold), followed by incubation at 37 °C for 24 h. Alternatively, filtered and diluted (100-fold in PBS) faeces from the 2-mix+WT P. clara-colonized mice was incubated at 37 °C for 24 h with different concentrations of recombinant mouse PRSS2 (0–16 µg ml−1). After incubation, the trypsin activity and the protein contents of the samples were analysed using a trypsin-activity assay and western blotting as described above.

Metagenomic analysis of the human gut microbiome

Metagenomes from human faecal samples from PRISM52, HMP253, FHS36, 500FG54, CVON55 and Jie56 were de novo assembled into a non-redundant gene catalogue, compiled into metagenomic species using MSPminer57 and quantified in terms of relative abundance in a previous study36. To search in the gene catalogue for the homologues of P. clara and P. xylanphila genes from the trypsin-associated locus containing the genes 00502 and 00509, as well six other neighbouring genes, we used USEARCH58 UBLAST (at protein level) retaining hits with a minimum e value of 0.1. We confirmed the presence of all 8 genes in both species in the gene catalogue. To identify additional plausible homologues and species encoding this locus, we first evaluated the similarity between the corresponding homologues in P. clara and P. xylanphila, and set the following thresholds of minimal identity (Id) and coverage (Cov) for UBLAST hits to each gene in the locus: 00502, Id = 25%, Cov = 90%; 00503, Id = 70%, Cov = 90%; 00504, Id = 60%, Cov = 90%; 00505, Id = 60%, Cov = 90%; 00506, Id = 50%, Cov = 90%; 00507, Id = 25%, Cov = 90%; 00508, Id = 45%, Cov = 80%; 00509, Id = 20%, Cov = 30%. We then evaluated which other metagenomic species encoded homologues of P. clara and P. xylanphila 0050200509, identifying MSP 0355 and MSP 0303. Although MSP 0355 and MSP 0303 were previously annotated to only the phylum Bacteroidetes36, we used UBLAST to compare their proteomes to the unified human gastrointestinal genome (UHGG) collection59. In both cases, most of the genes (>90%) mapped with high confidence (median amino acid identity >99% and e < 1 × 10−184) to a single species representative in UHGG, annotating MSP 0355 and MSP 0303 as GUT_GENOME140082 and GUT_GENOME016875, respectively; in UHGG59, both were phylogenetically classified as Paraprevotella spp. Moreover, we identified five MSPs that encoded homologues of only 00502 and 00509: MSP 0081, MSP 0224, MSP 0288, MSP 0410 and MSP 0435. To evaluate which individuals in the COVID-19 cohort (described below) carried P. clara’s gene 00502 or its homologues, we quality controlled faecal metagenomic data using Trim_Galore! to detect and remove sequencing adapters (minimum overlap of 5 bp) and KneadData v.0.7.2 to remove human DNA contamination and trim low-quality sequences (HEADCROP:15, SLIDINGWINDOW:1:20), and retained reads that were at least 50 bp long. Paired-end quality-filtered reads were mapped to the same gene catalogue from a previous study36 with BWA60, filtered to include strong mappings with at least 95% sequence identity over the length of the read, counted and normalized to transcripts per million (TPM matrix). Detection (TMP > 0) of any of the 00502 homologues classified the sample as containing a 00502 gene in their gut microbiome. All of the metagenomic samples in the COVID-19 cohort had at least 8 million reads after quality filtering.

AlphaFold modelling

The amino acids sequences of 00502 from P. clara, P. xylaniohila, P. rara, P. rodentium and P. muris were retrieved from GenBank (NZ_JH376591, EGG54658, LFQU01000025, NZ_JABKKH010000006 and NZ_JABKKF010000005, respectively). 00502 models were predicted using AlphaFold2 (ref. 61) through ColabFold62—an online platform for protein folding. Model confidence was evaluated through pLDDT scores, with a pLDDT > 90 considered to be very high model confidence. The resulting AlphaFold models were then aligned in PyMOL (Schrödinger) and visualized in ChimeraX63.

COVID-19 cohort

The COVID-19 cohort was recruited as a part of the Japan COVID-19 Task Force (JCTF) study64. According to the study protocol approved by the institutional review board at Keio University (code 20190337), we recruited 146 patients who were diagnosed as having COVID-19 by physicians using the clinical manifestation and PCR test results and were hospitalized at Keio University Hospital from March 2020 to September 2021. Informed consent was obtained from each participant. Approximately 2 months after discharge from the hospital, faecal samples were collected and sent to the laboratory in DNA/RNA Shield (Zymo Research). Among the 146 participants, information of oxygen inhalation was available for all participants, whereas that of diarrhoea incidence was available for 141 cases from the medical records during hospital care. Microbial DNA was extracted from 100 μl of faecal suspension as described above. Extracted DNA was sheared using M220 Focused-ultrasonicater (Covaris) to obtain fragmented DNA of around 500 bp. Metagenomic sequencing libraries were prepared from 200 ng of fragmented DNA using the TruSeq DNA Nano Library Preparation kit with IDT for Illumina-TruSeq DNA UD Indexes (Illumina) according to the manufacturer’s recommended protocol. Libraries were pooled by equal DNA amount, and library size and concentration were evaluated using the 4200 TapeStation (Agilent Technologies) and Qubit 3 Fluorometer (Invitrogen), respectively. Sequencing was performed on the Illumina NovaSeq 6000 system with 151 bp paired-end reads. The quality control for the metagenomic data was conducted using ParDRe v.2.1.5 (ref. 65) to remove duplicated reads, and fastp v.0.20.0 (ref. 66) to remove low-quality sequences (67) was used to remove PhiX and human DNA contamination.

Statistics

All statistical analyses were performed using GraphPad Prism software (GraphPad Software) and Excel. One-way ANOVA with Tukey’s test was used for multiple comparisons. Mann–Whitney U-tests with Welch’s correction (nonparametric) or unpaired t-tests (parametric) were used for comparisons between two groups. Spearman rank correlation was used to investigate the correlation between two variables. log-rank (Mantel-Cox) tests were used for survival analysis. One-sided Fisher’s tests were used to determine whether two groups differ in the proportion with which they fall into the two classifications.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.



Source link

By AUTHOR

Leave a Reply

Your email address will not be published.